Incidental Mutation 'R5797:Atp4a'
ID 447272
Institutional Source Beutler Lab
Gene Symbol Atp4a
Ensembl Gene ENSMUSG00000005553
Gene Name ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Synonyms H+/K+-ATPase alpha, H+K+-transporting alpha 1
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R5797 (G1)
Quality Score 219
Status Not validated
Chromosome 7
Chromosomal Location 30712209-30725534 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30712649 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 65 (Y65C)
Ref Sequence ENSEMBL: ENSMUSP00000131964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000005692
AA Change: Y65C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: Y65C

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167761
Predicted Effect probably damaging
Transcript: ENSMUST00000170371
AA Change: Y65C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: Y65C

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Atp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Atp4a APN 7 30713204 missense possibly damaging 0.95
IGL01327:Atp4a APN 7 30713250 missense possibly damaging 0.96
IGL01510:Atp4a APN 7 30720791 missense probably benign 0.02
IGL01763:Atp4a APN 7 30715518 missense probably benign 0.20
IGL02061:Atp4a APN 7 30715029 missense probably damaging 1.00
IGL02435:Atp4a APN 7 30717057 missense probably benign
IGL02903:Atp4a APN 7 30715919 missense probably benign 0.00
IGL03181:Atp4a APN 7 30724704 missense probably benign 0.02
IGL03350:Atp4a APN 7 30720867 missense probably damaging 1.00
atypical UTSW 7 30715356 missense possibly damaging 0.84
sublytic UTSW 7 30715800 missense probably benign 0.32
IGL03097:Atp4a UTSW 7 30723037 missense probably benign 0.14
R0095:Atp4a UTSW 7 30720735 missense probably damaging 0.99
R0121:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0140:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0241:Atp4a UTSW 7 30717135 missense probably benign 0.00
R0437:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0624:Atp4a UTSW 7 30718999 missense probably benign
R1164:Atp4a UTSW 7 30717692 missense probably benign 0.00
R2105:Atp4a UTSW 7 30720368 critical splice donor site probably null
R2272:Atp4a UTSW 7 30715500 nonsense probably null
R2327:Atp4a UTSW 7 30720241 missense probably benign 0.16
R2881:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2990:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2992:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2993:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3123:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3125:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3441:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3442:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3686:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3687:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3845:Atp4a UTSW 7 30717115 missense probably null 0.99
R4027:Atp4a UTSW 7 30724952 splice site probably null
R4072:Atp4a UTSW 7 30715332 missense probably benign 0.09
R4433:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4454:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4457:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4458:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4510:Atp4a UTSW 7 30724253 nonsense probably null
R4511:Atp4a UTSW 7 30724253 nonsense probably null
R4576:Atp4a UTSW 7 30717722 missense probably benign 0.25
R4656:Atp4a UTSW 7 30719948 intron probably benign
R4661:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4662:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4852:Atp4a UTSW 7 30724268 missense probably benign 0.10
R4892:Atp4a UTSW 7 30712474 missense probably benign 0.07
R4907:Atp4a UTSW 7 30719092 missense possibly damaging 0.66
R5024:Atp4a UTSW 7 30715864 missense possibly damaging 0.82
R5254:Atp4a UTSW 7 30715530 missense probably damaging 1.00
R5318:Atp4a UTSW 7 30715329 missense probably damaging 1.00
R5340:Atp4a UTSW 7 30720806 missense probably benign
R5484:Atp4a UTSW 7 30720672 unclassified probably benign
R5729:Atp4a UTSW 7 30712426 missense possibly damaging 0.48
R5762:Atp4a UTSW 7 30719096 missense probably damaging 0.99
R6030:Atp4a UTSW 7 30722516 missense probably damaging 0.99
R6030:Atp4a UTSW 7 30722516 missense probably damaging 0.99
R6077:Atp4a UTSW 7 30715919 missense probably benign 0.00
R6243:Atp4a UTSW 7 30715957 missense possibly damaging 0.68
R6346:Atp4a UTSW 7 30715356 missense possibly damaging 0.84
R6459:Atp4a UTSW 7 30712462 missense probably benign 0.00
R6515:Atp4a UTSW 7 30712478 missense possibly damaging 0.78
R6773:Atp4a UTSW 7 30715377 missense probably damaging 0.98
R6854:Atp4a UTSW 7 30715008 missense probably benign 0.29
R7215:Atp4a UTSW 7 30717360 missense possibly damaging 0.61
R7271:Atp4a UTSW 7 30722519 missense probably benign 0.16
R7340:Atp4a UTSW 7 30716730 missense possibly damaging 0.94
R7457:Atp4a UTSW 7 30720767 missense probably benign 0.08
R7593:Atp4a UTSW 7 30724680 missense probably benign 0.08
R7712:Atp4a UTSW 7 30715553 missense probably damaging 0.96
R7762:Atp4a UTSW 7 30720036 missense probably damaging 0.96
R8714:Atp4a UTSW 7 30720588 missense probably damaging 0.99
R9324:Atp4a UTSW 7 30715782 missense probably benign 0.02
Z1177:Atp4a UTSW 7 30717840 missense possibly damaging 0.47
Z1186:Atp4a UTSW 7 30717357 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGTGGGGACATGACTGC -3'
(R):5'- TGTCACGGTGGAGGCTACAG -3'

Sequencing Primer
(F):5'- ACATGACTGCCAAGATGAGC -3'
(R):5'- GCATAGTCTCTTCTCTTTGCCATG -3'
Posted On 2016-12-15