Incidental Mutation 'R5797:Fbrs'
ID447273
Institutional Source Beutler Lab
Gene Symbol Fbrs
Ensembl Gene ENSMUSG00000042423
Gene Namefibrosin
SynonymsFbs1
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127479199-127491711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127487291 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 604 (H604Q)
Ref Sequence ENSEMBL: ENSMUSP00000145783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048896] [ENSMUST00000205432] [ENSMUST00000206394]
Predicted Effect probably damaging
Transcript: ENSMUST00000048896
AA Change: H90Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043682
Gene: ENSMUSG00000042423
AA Change: H90Q

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Pfam:Auts2 82 282 4.8e-73 PFAM
low complexity region 298 310 N/A INTRINSIC
SCOP:d1gkub1 311 336 3e-6 SMART
low complexity region 341 361 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
low complexity region 435 464 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196180
Predicted Effect probably damaging
Transcript: ENSMUST00000205432
AA Change: H604Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205696
Predicted Effect unknown
Transcript: ENSMUST00000205803
AA Change: H61Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205967
Predicted Effect probably damaging
Transcript: ENSMUST00000206394
AA Change: H2Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000206484
AA Change: H56Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206980
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fibrosin is a lymphokine secreted by activated lymphocytes that induces fibroblast proliferation (Prakash and Robbins, 1998 [PubMed 9809749]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Fbrs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02476:Fbrs APN 7 127487669 missense probably damaging 1.00
R0096:Fbrs UTSW 7 127489487 missense probably damaging 0.99
R0096:Fbrs UTSW 7 127489487 missense probably damaging 0.99
R0133:Fbrs UTSW 7 127489610 splice site probably benign
R1579:Fbrs UTSW 7 127485357 missense probably damaging 1.00
R1617:Fbrs UTSW 7 127487711 missense probably damaging 1.00
R1640:Fbrs UTSW 7 127487311 missense probably damaging 1.00
R1958:Fbrs UTSW 7 127485991 missense possibly damaging 0.48
R2426:Fbrs UTSW 7 127487339 splice site probably null
R5952:Fbrs UTSW 7 127487752 missense probably damaging 0.99
R6659:Fbrs UTSW 7 127487919 missense probably damaging 1.00
R6988:Fbrs UTSW 7 127479508 unclassified probably benign
R7055:Fbrs UTSW 7 127487784 critical splice donor site probably null
R7319:Fbrs UTSW 7 127482813 missense possibly damaging 0.94
R7349:Fbrs UTSW 7 127482799 missense probably damaging 0.99
R7423:Fbrs UTSW 7 127489461 nonsense probably null
R7760:Fbrs UTSW 7 127489400 missense probably damaging 0.96
R8199:Fbrs UTSW 7 127487784 critical splice donor site probably null
R8458:Fbrs UTSW 7 127483157 missense probably damaging 0.98
R8459:Fbrs UTSW 7 127483157 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTCAGGCTGCATGAGGTTG -3'
(R):5'- AGAACCCGGGTGCTATAGAAC -3'

Sequencing Primer
(F):5'- AGGGCTTTTAAGTCACAGCC -3'
(R):5'- CCCGGGTGCTATAGAACTGCTTAG -3'
Posted On2016-12-15