Incidental Mutation 'R5797:6430573F11Rik'
ID447275
Institutional Source Beutler Lab
Gene Symbol 6430573F11Rik
Ensembl Gene ENSMUSG00000039620
Gene NameRIKEN cDNA 6430573F11 gene
Synonyms
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5797 (G1)
Quality Score206
Status Not validated
Chromosome8
Chromosomal Location36457548-36516570 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 36498415 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 30 (K30*)
Ref Sequence ENSEMBL: ENSMUSP00000127875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135373] [ENSMUST00000147525] [ENSMUST00000152039] [ENSMUST00000171777]
Predicted Effect probably null
Transcript: ENSMUST00000135373
AA Change: K30*
SMART Domains Protein: ENSMUSP00000120524
Gene: ENSMUSG00000039620
AA Change: K30*

DomainStartEndE-ValueType
Pfam:Methyltransf_11 49 114 7.7e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147525
AA Change: K30*
SMART Domains Protein: ENSMUSP00000119912
Gene: ENSMUSG00000039620
AA Change: K30*

DomainStartEndE-ValueType
Pfam:Methyltransf_8 4 158 3.6e-9 PFAM
Pfam:Ubie_methyltran 9 153 2.9e-7 PFAM
Pfam:Methyltransf_23 23 184 4.2e-12 PFAM
Pfam:Methyltransf_31 42 186 1.3e-10 PFAM
Pfam:Methyltransf_25 48 135 4.2e-9 PFAM
Pfam:Methyltransf_12 49 137 4.1e-11 PFAM
Pfam:Methyltransf_11 49 139 3.6e-18 PFAM
low complexity region 377 387 N/A INTRINSIC
low complexity region 410 430 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000152039
AA Change: K30*
SMART Domains Protein: ENSMUSP00000119288
Gene: ENSMUSG00000039620
AA Change: K30*

DomainStartEndE-ValueType
Pfam:Methyltransf_11 49 109 2.9e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171777
AA Change: K30*
SMART Domains Protein: ENSMUSP00000127875
Gene: ENSMUSG00000039620
AA Change: K30*

DomainStartEndE-ValueType
Pfam:Methyltransf_8 4 158 3.6e-9 PFAM
Pfam:Ubie_methyltran 9 153 2.9e-7 PFAM
Pfam:Methyltransf_23 23 186 1.5e-11 PFAM
Pfam:Methyltransf_31 42 186 3.5e-10 PFAM
Pfam:Methyltransf_25 48 135 4.3e-9 PFAM
Pfam:Methyltransf_12 49 137 4.1e-11 PFAM
Pfam:Methyltransf_11 49 139 3.2e-18 PFAM
low complexity region 377 387 N/A INTRINSIC
low complexity region 410 430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in 6430573F11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:6430573F11Rik APN 8 36512299 missense possibly damaging 0.90
IGL01360:6430573F11Rik APN 8 36512559 missense probably benign 0.08
IGL01364:6430573F11Rik APN 8 36512347 missense probably benign 0.03
IGL03401:6430573F11Rik APN 8 36505669 missense probably damaging 1.00
Bear_market UTSW 8 36498483 critical splice donor site probably null
R2161:6430573F11Rik UTSW 8 36505650 missense probably damaging 1.00
R2230:6430573F11Rik UTSW 8 36512553 missense probably damaging 1.00
R2232:6430573F11Rik UTSW 8 36512553 missense probably damaging 1.00
R4250:6430573F11Rik UTSW 8 36512212 missense probably benign 0.05
R4432:6430573F11Rik UTSW 8 36498478 missense probably damaging 1.00
R4491:6430573F11Rik UTSW 8 36505606 missense probably damaging 1.00
R5242:6430573F11Rik UTSW 8 36511930 missense probably benign 0.02
R5261:6430573F11Rik UTSW 8 36511924 missense probably benign 0.07
R5482:6430573F11Rik UTSW 8 36512049 missense probably benign
R5579:6430573F11Rik UTSW 8 36512041 missense probably benign 0.00
R5594:6430573F11Rik UTSW 8 36512298 missense probably benign 0.00
R6481:6430573F11Rik UTSW 8 36498483 critical splice donor site probably null
R7504:6430573F11Rik UTSW 8 36512155 missense probably benign 0.03
R8119:6430573F11Rik UTSW 8 36498422 nonsense probably null
R8169:6430573F11Rik UTSW 8 36511703 missense probably damaging 0.97
X0057:6430573F11Rik UTSW 8 36511988 nonsense probably null
X0065:6430573F11Rik UTSW 8 36511856 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACAAAGACCAGCAAAGCTTTTG -3'
(R):5'- TTCAAGAGACTACCATGCTACTAAC -3'

Sequencing Primer
(F):5'- ATTGACTTCCAGGCATCTAGGACG -3'
(R):5'- TACCAATGTCAGCGACGA -3'
Posted On2016-12-15