Incidental Mutation 'R5797:Canx'
ID447284
Institutional Source Beutler Lab
Gene Symbol Canx
Ensembl Gene ENSMUSG00000020368
Gene Namecalnexin
Synonyms1110069N15Rik, CNX
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50293961-50325673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50301017 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 356 (I356V)
Ref Sequence ENSEMBL: ENSMUSP00000137440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000179865]
Predicted Effect probably benign
Transcript: ENSMUST00000020637
AA Change: I356V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368
AA Change: I356V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 72 441 1.7e-170 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155801
Predicted Effect probably benign
Transcript: ENSMUST00000179865
AA Change: I356V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368
AA Change: I356V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 70 441 4.7e-166 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit motor defects, loss of large myelinated nerve fibers, small size, and very high mortality between birth and 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Canx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Canx APN 11 50300996 missense possibly damaging 0.61
IGL03089:Canx APN 11 50304482 missense possibly damaging 0.85
R1428:Canx UTSW 11 50308394 splice site probably benign
R1876:Canx UTSW 11 50304359 missense probably damaging 1.00
R2057:Canx UTSW 11 50304425 missense probably damaging 0.97
R2058:Canx UTSW 11 50304425 missense probably damaging 0.97
R2088:Canx UTSW 11 50310390 missense possibly damaging 0.89
R2126:Canx UTSW 11 50304358 missense probably damaging 1.00
R2217:Canx UTSW 11 50310867 missense probably benign 0.24
R2218:Canx UTSW 11 50310867 missense probably benign 0.24
R2386:Canx UTSW 11 50297106 missense probably benign
R3716:Canx UTSW 11 50304474 missense probably benign 0.14
R3957:Canx UTSW 11 50308383 missense probably damaging 1.00
R4019:Canx UTSW 11 50299245 missense probably damaging 1.00
R4402:Canx UTSW 11 50304438 missense probably benign 0.13
R4825:Canx UTSW 11 50308809 missense probably benign 0.42
R5252:Canx UTSW 11 50308794 missense probably damaging 1.00
R5385:Canx UTSW 11 50301812 missense probably damaging 1.00
R5820:Canx UTSW 11 50308383 missense probably damaging 1.00
R6052:Canx UTSW 11 50297119 missense possibly damaging 0.49
R7259:Canx UTSW 11 50301816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTTGCCCAGACACGAAC -3'
(R):5'- GCAATAGCTATGTGCCCCTCTC -3'

Sequencing Primer
(F):5'- CAATCATTGGAGGCTTCC -3'
(R):5'- GATCACTGAGTTCTAGGACAGCC -3'
Posted On2016-12-15