Mutagenetix > Incidental Mutation

Incidental Mutation 'R5797:Canx'

447284

Institutional Source

Beutler Lab

Gene Symbol

Canx

Ensembl Gene

ENSMUSG00000020368

Gene Name

calnexin

Synonyms

1110069N15Rik, CNX

MMRRC Submission

043209-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R5797 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

50293961-50325673 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50301017 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 356 (I356V)

Ref Sequence

ENSEMBL: ENSMUSP00000137440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000179865]

AlphaFold

P35564

Predicted Effect

probably benign
Transcript: ENSMUST00000020637
AA Change: I356V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368
AA Change: I356V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Calreticulin	72	441	1.7e-170	PFAM
transmembrane domain	484	506	N/A	INTRINSIC
coiled coil region	525	560	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146979

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153068

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155801

Predicted Effect

probably benign
Transcript: ENSMUST00000179865
AA Change: I356V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368
AA Change: I356V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Calreticulin	70	441	4.7e-166	PFAM
transmembrane domain	484	506	N/A	INTRINSIC
coiled coil region	525	560	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit motor defects, loss of large myelinated nerve fibers, small size, and very high mortality between birth and 4 weeks of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430573F11Rik	A	T	8: 36,498,415	K30*	probably null	Het
Abhd18	T	C	3: 40,933,551	F277L	probably benign	Het
Acsf2	A	G	11: 94,571,679	V170A	probably damaging	Het
Amz2	G	T	11: 109,427,079		probably benign	Het
Atp4a	A	G	7: 30,712,649	Y65C	probably damaging	Het
Cfap54	T	A	10: 92,967,576	T1535S	probably benign	Het
Cts3	A	T	13: 61,568,392	W52R	probably damaging	Het
Cyb5rl	A	T	4: 107,084,207	E276D	possibly damaging	Het
Dhx30	T	C	9: 110,098,820	N78S	probably damaging	Het
Dmap1	A	T	4: 117,675,480	V333E	possibly damaging	Het
Dnah10	A	G	5: 124,821,386	E3744G	probably benign	Het
Efcab6	C	T	15: 83,924,277	C828Y	possibly damaging	Het
Fam227b	A	C	2: 126,007,334	I326S	probably benign	Het
Fbrs	C	A	7: 127,487,291	H604Q	probably damaging	Het
Fshr	T	G	17: 89,011,075	N129T	probably damaging	Het
Gja3	T	C	14: 57,035,713	R401G	probably damaging	Het
Gm572	G	A	4: 148,666,798	M209I	probably benign	Het
Gne	G	A	4: 44,060,030	T121M	probably damaging	Het
Gnmt	T	C	17: 46,726,379	N160D	probably damaging	Het
Kalrn	T	C	16: 34,212,249	Y1125C	probably damaging	Het
Kif2a	A	T	13: 106,975,376	C524S	probably damaging	Het
Kl	A	G	5: 150,991,538	N910S	possibly damaging	Het
Lrrtm2	C	T	18: 35,213,706	R181H	probably damaging	Het
Mkln1	A	G	6: 31,433,069	D214G	probably benign	Het
Muc5b	C	A	7: 141,851,582	T909N	unknown	Het
Myh13	T	A	11: 67,335,002	D335E	possibly damaging	Het
Myo5b	A	G	18: 74,701,521	E884G	probably benign	Het
Naip1	T	C	13: 100,444,526	D71G	possibly damaging	Het
Nxpe4	T	A	9: 48,396,538	I314N	possibly damaging	Het
Pcnt	T	C	10: 76,392,756	E1525G	probably benign	Het
Pkd1	T	A	17: 24,592,641	H153Q	possibly damaging	Het
Prkdc	T	A	16: 15,737,834	Y2157*	probably null	Het
Scd3	T	C	19: 44,215,511	I46T	probably benign	Het
Sdha	A	T	13: 74,334,357	M279K	probably damaging	Het
Slco4c1	A	G	1: 96,819,104	V671A	probably benign	Het
Slitrk3	T	A	3: 73,048,629	T937S	probably damaging	Het
Sncaip	A	T	18: 52,898,204	T442S	probably benign	Het
Sptb	T	C	12: 76,603,699	D1748G	possibly damaging	Het
Vmn2r12	A	T	5: 109,085,870	C825*	probably null	Het

Other mutations in Canx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Canx	APN	11	50300996	missense	possibly damaging	0.61
IGL03089:Canx	APN	11	50304482	missense	possibly damaging	0.85
R1428:Canx	UTSW	11	50308394	splice site	probably benign
R1876:Canx	UTSW	11	50304359	missense	probably damaging	1.00
R2057:Canx	UTSW	11	50304425	missense	probably damaging	0.97
R2058:Canx	UTSW	11	50304425	missense	probably damaging	0.97
R2088:Canx	UTSW	11	50310390	missense	possibly damaging	0.89
R2126:Canx	UTSW	11	50304358	missense	probably damaging	1.00
R2217:Canx	UTSW	11	50310867	missense	probably benign	0.24
R2218:Canx	UTSW	11	50310867	missense	probably benign	0.24
R2386:Canx	UTSW	11	50297106	missense	probably benign
R3716:Canx	UTSW	11	50304474	missense	probably benign	0.14
R3957:Canx	UTSW	11	50308383	missense	probably damaging	1.00
R4019:Canx	UTSW	11	50299245	missense	probably damaging	1.00
R4402:Canx	UTSW	11	50304438	missense	probably benign	0.13
R4825:Canx	UTSW	11	50308809	missense	probably benign	0.42
R5252:Canx	UTSW	11	50308794	missense	probably damaging	1.00
R5385:Canx	UTSW	11	50301812	missense	probably damaging	1.00
R5820:Canx	UTSW	11	50308383	missense	probably damaging	1.00
R6052:Canx	UTSW	11	50297119	missense	possibly damaging	0.49
R7259:Canx	UTSW	11	50301816	missense	probably damaging	1.00
R7603:Canx	UTSW	11	50311628	missense	probably benign
R7715:Canx	UTSW	11	50310804	missense	probably benign	0.13
R7735:Canx	UTSW	11	50301039	missense	probably damaging	0.97
R8063:Canx	UTSW	11	50308346	nonsense	probably null
R8069:Canx	UTSW	11	50311704	missense	possibly damaging	0.93
R8494:Canx	UTSW	11	50311782	critical splice acceptor site	probably null
R8508:Canx	UTSW	11	50311647	missense	possibly damaging	0.85
R8941:Canx	UTSW	11	50304443	missense	possibly damaging	0.90
R9153:Canx	UTSW	11	50297335	missense	probably benign
R9722:Canx	UTSW	11	50304474	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- GCTTTTGCCCAGACACGAAC -3'
(R):5'- GCAATAGCTATGTGCCCCTCTC -3'

Sequencing Primer
(F):5'- CAATCATTGGAGGCTTCC -3'
(R):5'- GATCACTGAGTTCTAGGACAGCC -3'

Posted On

2016-12-15