Incidental Mutation 'R5797:Sptb'
ID447286
Institutional Source Beutler Lab
Gene Symbol Sptb
Ensembl Gene ENSMUSG00000021061
Gene Namespectrin beta, erythrocytic
SynonymsLOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R5797 (G1)
Quality Score221
Status Not validated
Chromosome12
Chromosomal Location76580488-76710547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76603699 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1748 (D1748G)
Ref Sequence ENSEMBL: ENSMUSP00000129782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021458
AA Change: D1748G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: D1748G

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.04e-10 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2193 4.32e-9 SMART
PH 2180 2291 8.98e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166101
AA Change: D1748G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: D1748G

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.87e-11 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2117 1.16e-9 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Sptb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Sptb APN 12 76621331 missense probably benign 0.00
IGL00160:Sptb APN 12 76623169 missense probably damaging 1.00
IGL00229:Sptb APN 12 76620753 missense probably benign 0.20
IGL00820:Sptb APN 12 76632477 missense probably damaging 1.00
IGL01309:Sptb APN 12 76587463 missense probably benign 0.16
IGL01408:Sptb APN 12 76613147 missense possibly damaging 0.93
IGL01450:Sptb APN 12 76624240 missense possibly damaging 0.89
IGL01455:Sptb APN 12 76612912 missense probably damaging 1.00
IGL01457:Sptb APN 12 76612555 splice site probably benign
IGL01680:Sptb APN 12 76630682 missense probably damaging 1.00
IGL02070:Sptb APN 12 76605539 missense possibly damaging 0.82
IGL02346:Sptb APN 12 76621014 missense probably damaging 1.00
IGL02452:Sptb APN 12 76609036 critical splice donor site probably null
IGL02515:Sptb APN 12 76606487 missense possibly damaging 0.51
IGL02545:Sptb APN 12 76607980 critical splice donor site probably null
IGL02644:Sptb APN 12 76605617 missense probably damaging 1.00
IGL02878:Sptb APN 12 76620753 missense probably benign 0.20
IGL03007:Sptb APN 12 76621341 missense probably damaging 1.00
IGL03220:Sptb APN 12 76612910 missense probably benign 0.06
IGL03343:Sptb APN 12 76583556 unclassified probably benign
IGL03098:Sptb UTSW 12 76621499 missense probably damaging 1.00
PIT4472001:Sptb UTSW 12 76620686 missense probably damaging 1.00
R0047:Sptb UTSW 12 76622950 missense probably damaging 0.99
R0365:Sptb UTSW 12 76600383 missense probably benign 0.12
R0373:Sptb UTSW 12 76621371 missense probably benign 0.03
R0704:Sptb UTSW 12 76583594 missense probably damaging 0.99
R1005:Sptb UTSW 12 76601859 critical splice donor site probably null
R1109:Sptb UTSW 12 76603603 missense probably damaging 1.00
R1264:Sptb UTSW 12 76612607 missense probably damaging 1.00
R1358:Sptb UTSW 12 76621321 frame shift probably null
R1358:Sptb UTSW 12 76621326 missense probably damaging 1.00
R1459:Sptb UTSW 12 76611883 missense probably benign 0.01
R1518:Sptb UTSW 12 76604024 missense possibly damaging 0.95
R1628:Sptb UTSW 12 76583848 missense probably damaging 1.00
R1668:Sptb UTSW 12 76621169 missense probably benign
R1677:Sptb UTSW 12 76629649 missense probably damaging 1.00
R1687:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R1695:Sptb UTSW 12 76620867 missense probably benign 0.10
R1708:Sptb UTSW 12 76612574 missense probably damaging 1.00
R1761:Sptb UTSW 12 76612608 missense probably damaging 0.96
R1925:Sptb UTSW 12 76622253 missense probably damaging 1.00
R2011:Sptb UTSW 12 76632472 missense possibly damaging 0.95
R2373:Sptb UTSW 12 76621161 missense probably damaging 1.00
R2517:Sptb UTSW 12 76649869 missense possibly damaging 0.55
R2918:Sptb UTSW 12 76598758 missense probably damaging 0.97
R2961:Sptb UTSW 12 76603582 missense probably benign 0.19
R3409:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3410:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3411:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3744:Sptb UTSW 12 76600400 missense probably benign
R4112:Sptb UTSW 12 76597779 missense probably damaging 0.99
R4177:Sptb UTSW 12 76613179 missense probably benign 0.25
R4194:Sptb UTSW 12 76613010 missense probably benign 0.44
R4301:Sptb UTSW 12 76612697 missense probably damaging 1.00
R4555:Sptb UTSW 12 76612851 missense probably benign 0.03
R4619:Sptb UTSW 12 76583807 nonsense probably null
R4620:Sptb UTSW 12 76583807 nonsense probably null
R4625:Sptb UTSW 12 76587326 splice site probably null
R4728:Sptb UTSW 12 76583379 missense probably benign 0.00
R4751:Sptb UTSW 12 76627110 missense probably benign 0.07
R4810:Sptb UTSW 12 76623197 nonsense probably null
R4888:Sptb UTSW 12 76609037 missense probably benign 0.00
R4894:Sptb UTSW 12 76624994 critical splice donor site probably null
R5114:Sptb UTSW 12 76609278 missense probably damaging 1.00
R5191:Sptb UTSW 12 76612834 missense probably benign 0.12
R5479:Sptb UTSW 12 76599851 missense probably benign 0.04
R5646:Sptb UTSW 12 76587441 missense probably benign
R5725:Sptb UTSW 12 76623114 missense probably benign 0.25
R5727:Sptb UTSW 12 76623114 missense probably benign 0.25
R5874:Sptb UTSW 12 76598727 missense possibly damaging 0.91
R5952:Sptb UTSW 12 76632384 missense probably benign 0.02
R5956:Sptb UTSW 12 76604168 missense probably benign
R6298:Sptb UTSW 12 76620654 critical splice donor site probably null
R6470:Sptb UTSW 12 76612829 missense probably damaging 1.00
R6477:Sptb UTSW 12 76606392 missense probably damaging 1.00
R6736:Sptb UTSW 12 76613180 missense possibly damaging 0.49
R6854:Sptb UTSW 12 76603480 missense probably damaging 1.00
R6969:Sptb UTSW 12 76608007 missense probably damaging 1.00
R6987:Sptb UTSW 12 76613247 missense probably benign 0.00
R7023:Sptb UTSW 12 76625088 missense probably damaging 1.00
R7366:Sptb UTSW 12 76604194 missense probably damaging 1.00
R7379:Sptb UTSW 12 76610877 missense probably damaging 1.00
R7389:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7392:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7477:Sptb UTSW 12 76628565 missense probably damaging 1.00
R7653:Sptb UTSW 12 76628497 missense probably benign 0.06
R7684:Sptb UTSW 12 76612195 missense probably benign 0.06
R7733:Sptb UTSW 12 76597921 splice site probably null
R7846:Sptb UTSW 12 76608526 nonsense probably null
R8048:Sptb UTSW 12 76628559 missense probably benign 0.02
R8261:Sptb UTSW 12 76621262 missense probably benign 0.06
R8324:Sptb UTSW 12 76619162 missense possibly damaging 0.73
R8512:Sptb UTSW 12 76602052 missense possibly damaging 0.51
R8515:Sptb UTSW 12 76612041 missense probably benign 0.10
R8558:Sptb UTSW 12 76612787 missense probably benign 0.09
R8872:Sptb UTSW 12 76612039 missense probably benign 0.37
X0057:Sptb UTSW 12 76630739 missense probably benign
Z1176:Sptb UTSW 12 76620733 nonsense probably null
Z1177:Sptb UTSW 12 76583584 missense probably damaging 1.00
Z1177:Sptb UTSW 12 76606445 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATCTATGAGGCCCAGGATCTCG -3'
(R):5'- TCACACAAGTGGAGAACAGC -3'

Sequencing Primer
(F):5'- ATCTCGGTGCCTGTGTAGAAATAGC -3'
(R):5'- ACAGACAGTCTACCCTGGG -3'
Posted On2016-12-15