Incidental Mutation 'R5797:Cts3'
ID447287
Institutional Source Beutler Lab
Gene Symbol Cts3
Ensembl Gene ENSMUSG00000074870
Gene Namecathepsin 3
Synonyms1600000I23Rik
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location61564630-61570127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61568392 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 52 (W52R)
Ref Sequence ENSEMBL: ENSMUSP00000153683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054702] [ENSMUST00000054702] [ENSMUST00000223815] [ENSMUST00000224855] [ENSMUST00000225902]
AlphaFold Q91ZD5
Predicted Effect probably damaging
Transcript: ENSMUST00000054702
AA Change: W52R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058359
Gene: ENSMUSG00000074870
AA Change: W52R

DomainStartEndE-ValueType
Inhibitor_I29 29 88 2.48e-24 SMART
Pept_C1 114 331 1.33e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000054702
AA Change: W52R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058359
Gene: ENSMUSG00000074870
AA Change: W52R

DomainStartEndE-ValueType
Inhibitor_I29 29 88 2.48e-24 SMART
Pept_C1 114 331 1.33e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223815
AA Change: W52R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224050
Predicted Effect probably damaging
Transcript: ENSMUST00000224855
AA Change: W52R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225515
Predicted Effect probably benign
Transcript: ENSMUST00000225902
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Cts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Cts3 APN 13 61568174 missense probably damaging 0.98
IGL02662:Cts3 APN 13 61568057 missense probably damaging 1.00
R0455:Cts3 UTSW 13 61568210 unclassified probably benign
R1673:Cts3 UTSW 13 61567554 nonsense probably null
R1793:Cts3 UTSW 13 61568153 missense probably benign 0.00
R2403:Cts3 UTSW 13 61564992 missense probably damaging 1.00
R3897:Cts3 UTSW 13 61564986 missense probably benign 0.04
R4012:Cts3 UTSW 13 61568054 critical splice donor site probably null
R4052:Cts3 UTSW 13 61568721 missense probably benign 0.27
R4669:Cts3 UTSW 13 61566823 missense probably benign 0.01
R4907:Cts3 UTSW 13 61566820 missense probably benign 0.01
R5121:Cts3 UTSW 13 61567595 missense probably benign 0.09
R5572:Cts3 UTSW 13 61564968 missense probably damaging 0.99
R5774:Cts3 UTSW 13 61568370 missense probably damaging 1.00
R5796:Cts3 UTSW 13 61568703 missense probably damaging 1.00
R6159:Cts3 UTSW 13 61566841 missense probably damaging 1.00
R6226:Cts3 UTSW 13 61568721 missense probably benign 0.27
R7346:Cts3 UTSW 13 61567620 missense probably benign 0.00
R7642:Cts3 UTSW 13 61568775 missense probably benign 0.02
R7948:Cts3 UTSW 13 61566049 missense probably benign 0.04
R8060:Cts3 UTSW 13 61566766 missense probably damaging 1.00
R9127:Cts3 UTSW 13 61567421 nonsense probably null
R9145:Cts3 UTSW 13 61564986 missense probably benign 0.04
Z1177:Cts3 UTSW 13 61568747 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGACTGGGATTTCAATCATC -3'
(R):5'- TGGTCAGGATCTCTGTTCCTAG -3'

Sequencing Primer
(F):5'- GGACTGGGATTTCAATCATCTCTTTC -3'
(R):5'- GTCAGGATCTCTGTTCCTAGACATG -3'
Posted On2016-12-15