Incidental Mutation 'R5797:Sdha'
ID447288
Institutional Source Beutler Lab
Gene Symbol Sdha
Ensembl Gene ENSMUSG00000021577
Gene Namesuccinate dehydrogenase complex, subunit A, flavoprotein (Fp)
SynonymsSDHF, FP, 2310034D06Rik, SDH2
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location74322254-74350280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74334357 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 279 (M279K)
Ref Sequence ENSEMBL: ENSMUSP00000022062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022062]
Predicted Effect probably damaging
Transcript: ENSMUST00000022062
AA Change: M279K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022062
Gene: ENSMUSG00000021577
AA Change: M279K

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:FAD_binding_2 63 457 1.2e-128 PFAM
Pfam:Succ_DH_flav_C 512 664 3.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161086
Predicted Effect probably benign
Transcript: ENSMUST00000221594
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major catalytic subunit of succinate-ubiquinone oxidoreductase, a complex of the mitochondrial respiratory chain. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. Mutations in this gene have been associated with a form of mitochondrial respiratory chain deficiency known as Leigh Syndrome. A pseudogene has been identified on chromosome 3q29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Sdha
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0270:Sdha UTSW 13 74332247 missense probably damaging 1.00
R0480:Sdha UTSW 13 74327333 missense probably benign 0.36
R0960:Sdha UTSW 13 74323184 splice site probably benign
R1883:Sdha UTSW 13 74333136 missense probably damaging 0.98
R1884:Sdha UTSW 13 74333136 missense probably damaging 0.98
R2068:Sdha UTSW 13 74323968 splice site probably null
R3881:Sdha UTSW 13 74339192 missense probably damaging 1.00
R3894:Sdha UTSW 13 74334391 missense probably benign 0.03
R4063:Sdha UTSW 13 74323958 intron probably benign
R4384:Sdha UTSW 13 74326985 missense possibly damaging 0.89
R5046:Sdha UTSW 13 74327333 missense probably damaging 1.00
R5432:Sdha UTSW 13 74326949 missense probably damaging 0.97
R5521:Sdha UTSW 13 74350099 intron probably benign
R5645:Sdha UTSW 13 74323839 critical splice donor site probably null
R5770:Sdha UTSW 13 74323120 nonsense probably null
R5920:Sdha UTSW 13 74326925 critical splice donor site probably null
R6450:Sdha UTSW 13 74334293 splice site probably null
R7677:Sdha UTSW 13 74333053 nonsense probably null
R7793:Sdha UTSW 13 74331436 missense probably damaging 1.00
R8284:Sdha UTSW 13 74331297 critical splice donor site probably null
Z1177:Sdha UTSW 13 74339632 missense probably damaging 1.00
Z1177:Sdha UTSW 13 74350193 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTTTATGGAACCAGGAGAAAC -3'
(R):5'- GTATGGCCTCCCACGTATTG -3'

Sequencing Primer
(F):5'- AACTCCCTGAGGACTCAAGGTG -3'
(R):5'- CGTGTATATACATGCATGGGGC -3'
Posted On2016-12-15