Incidental Mutation 'R5797:Gja3'
ID447292
Institutional Source Beutler Lab
Gene Symbol Gja3
Ensembl Gene ENSMUSG00000048582
Gene Namegap junction protein, alpha 3
SynonymsCx46, Gja-3, connexin 46, alpha 3 connexin
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location57034460-57058100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57035713 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 401 (R401G)
Ref Sequence ENSEMBL: ENSMUSP00000059587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061614] [ENSMUST00000223792]
Predicted Effect probably damaging
Transcript: ENSMUST00000061614
AA Change: R401G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059587
Gene: ENSMUSG00000048582
AA Change: R401G

DomainStartEndE-ValueType
CNX 43 76 4.4e-21 SMART
low complexity region 103 116 N/A INTRINSIC
Connexin_CCC 165 231 3.36e-44 SMART
low complexity region 342 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223792
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a connexin and is a component of lens fiber gap junctions. Defects in this gene are a cause of zonular pulverulent cataract type 3 (CZP3). [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutants exhibit lens nuclear cataracts associated with breakdown of gamma crystallin. Severity of the defect is influenced by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Gja3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Gja3 APN 14 57035679 missense probably damaging 1.00
R0470:Gja3 UTSW 14 57036427 missense probably damaging 1.00
R0631:Gja3 UTSW 14 57036762 missense possibly damaging 0.95
R1455:Gja3 UTSW 14 57036385 missense probably damaging 1.00
R1687:Gja3 UTSW 14 57036876 missense probably damaging 0.99
R2229:Gja3 UTSW 14 57036714 missense probably damaging 1.00
R3846:Gja3 UTSW 14 57035704 nonsense probably null
R5337:Gja3 UTSW 14 57035832 missense probably benign 0.22
R5940:Gja3 UTSW 14 57035860 missense probably damaging 0.99
R7226:Gja3 UTSW 14 57035893 missense probably benign 0.01
R8066:Gja3 UTSW 14 57035806 missense probably benign 0.00
Z1088:Gja3 UTSW 14 57035815 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AAACCAGACTGATCCAGTTTGCTC -3'
(R):5'- AAGCCCTCTTCAGCAGCATC -3'

Sequencing Primer
(F):5'- AATCCAGCACTGTCAGGTTTTTG -3'
(R):5'- GCATCCAGCCCTGATGG -3'
Posted On2016-12-15