Incidental Mutation 'R5797:Lrrtm2'
ID447299
Institutional Source Beutler Lab
Gene Symbol Lrrtm2
Ensembl Gene ENSMUSG00000071862
Gene Nameleucine rich repeat transmembrane neuronal 2
SynonymsC630011A14Rik
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location35209011-35215024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35213706 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 181 (R181H)
Ref Sequence ENSEMBL: ENSMUSP00000089225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042345] [ENSMUST00000091636]
Predicted Effect probably benign
Transcript: ENSMUST00000042345
SMART Domains Protein: ENSMUSP00000049007
Gene: ENSMUSG00000037815

DomainStartEndE-ValueType
Pfam:Vinculin 19 339 2.6e-99 PFAM
Pfam:Vinculin 333 867 3.3e-218 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091636
AA Change: R181H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089225
Gene: ENSMUSG00000071862
AA Change: R181H

DomainStartEndE-ValueType
LRRNT 33 61 2.45e0 SMART
LRR_TYP 84 107 5.14e-3 SMART
LRR_TYP 108 131 3.58e-2 SMART
LRR_TYP 132 155 1.6e-4 SMART
LRR_TYP 156 179 4.24e-4 SMART
LRR 180 203 1.14e0 SMART
LRR 204 224 6.05e0 SMART
LRR 228 251 5.12e1 SMART
LRR 252 275 1.97e2 SMART
LRR 276 299 2.45e0 SMART
Blast:LRRCT 311 360 2e-11 BLAST
transmembrane domain 422 444 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Lrrtm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Lrrtm2 APN 18 35213268 missense probably benign 0.13
IGL00835:Lrrtm2 APN 18 35214239 missense probably benign 0.03
IGL01097:Lrrtm2 APN 18 35212941 missense probably damaging 1.00
IGL01589:Lrrtm2 APN 18 35212798 missense probably damaging 1.00
IGL02106:Lrrtm2 APN 18 35212815 nonsense probably null
R0149:Lrrtm2 UTSW 18 35212932 missense probably benign 0.28
R0361:Lrrtm2 UTSW 18 35212932 missense probably benign 0.28
R0924:Lrrtm2 UTSW 18 35213755 missense probably damaging 1.00
R1189:Lrrtm2 UTSW 18 35213492 nonsense probably null
R1417:Lrrtm2 UTSW 18 35213958 missense probably damaging 1.00
R1585:Lrrtm2 UTSW 18 35213375 missense possibly damaging 0.86
R3433:Lrrtm2 UTSW 18 35213897 missense probably damaging 1.00
R4019:Lrrtm2 UTSW 18 35212870 missense possibly damaging 0.76
R4540:Lrrtm2 UTSW 18 35213146 missense probably benign 0.29
R4664:Lrrtm2 UTSW 18 35214257 splice site probably null
R4879:Lrrtm2 UTSW 18 35213319 missense probably damaging 0.98
R7378:Lrrtm2 UTSW 18 35213592 missense probably damaging 1.00
R7387:Lrrtm2 UTSW 18 35212972 missense probably damaging 1.00
R7391:Lrrtm2 UTSW 18 35212765 missense possibly damaging 0.75
R7408:Lrrtm2 UTSW 18 35213635 missense possibly damaging 0.88
R7584:Lrrtm2 UTSW 18 35212765 missense possibly damaging 0.75
R7629:Lrrtm2 UTSW 18 35214257 splice site probably null
R8105:Lrrtm2 UTSW 18 35213457 missense probably damaging 0.99
R8163:Lrrtm2 UTSW 18 35213724 missense probably damaging 1.00
Z1176:Lrrtm2 UTSW 18 35214659 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCATTGTAAGAAGAGTGTGTGCAG -3'
(R):5'- AAGACGCTTTCCAAGGACTG -3'

Sequencing Primer
(F):5'- TGTGCAGACTGCTTAGCC -3'
(R):5'- GACGCTTTCCAAGGACTGTATAAAC -3'
Posted On2016-12-15