Incidental Mutation 'R5797:Sncaip'
ID447300
Institutional Source Beutler Lab
Gene Symbol Sncaip
Ensembl Gene ENSMUSG00000024534
Gene Namesynuclein, alpha interacting protein (synphilin)
Synonymssynphilin-1, 4933427B05Rik, SYPH1
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location52767709-52915935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52898204 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 442 (T442S)
Ref Sequence ENSEMBL: ENSMUSP00000136838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025413] [ENSMUST00000115410] [ENSMUST00000163742] [ENSMUST00000177861] [ENSMUST00000178011] [ENSMUST00000178678] [ENSMUST00000178883] [ENSMUST00000179625] [ENSMUST00000179689] [ENSMUST00000180259]
Predicted Effect probably benign
Transcript: ENSMUST00000025413
AA Change: T502S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025413
Gene: ENSMUSG00000024534
AA Change: T502S

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115410
AA Change: T502S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111069
Gene: ENSMUSG00000024534
AA Change: T502S

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163742
AA Change: T502S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127189
Gene: ENSMUSG00000024534
AA Change: T502S

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177861
Predicted Effect probably benign
Transcript: ENSMUST00000178011
AA Change: T502S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000137549
Gene: ENSMUSG00000024534
AA Change: T502S

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178678
AA Change: T502S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000137367
Gene: ENSMUSG00000024534
AA Change: T502S

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
Pfam:SNCAIP_SNCA_bd 511 556 7.9e-30 PFAM
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178883
Predicted Effect probably benign
Transcript: ENSMUST00000179625
AA Change: T442S

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136838
Gene: ENSMUSG00000024534
AA Change: T442S

DomainStartEndE-ValueType
ANK 358 387 5.03e2 SMART
ANK 395 424 4.26e-4 SMART
PDB:2KES|A 451 489 9e-10 PDB
low complexity region 490 511 N/A INTRINSIC
low complexity region 596 609 N/A INTRINSIC
low complexity region 613 626 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 809 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179689
AA Change: T90S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000137107
Gene: ENSMUSG00000024534
AA Change: T90S

DomainStartEndE-ValueType
ANK 43 72 4.26e-4 SMART
PDB:2KES|A 99 137 6e-10 PDB
low complexity region 138 159 N/A INTRINSIC
low complexity region 244 257 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
low complexity region 333 343 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 457 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180259
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing several protein-protein interaction domains, including ankyrin-like repeats, a coiled-coil domain, and an ATP/GTP-binding motif. The encoded protein interacts with alpha-synuclein in neuronal tissue and may play a role in the formation of cytoplasmic inclusions and neurodegeneration. A mutation in this gene has been associated with Parkinson's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Sncaip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Sncaip APN 18 52884963 splice site probably null
IGL01554:Sncaip APN 18 52868934 missense possibly damaging 0.94
IGL01802:Sncaip APN 18 52869037 missense probably damaging 1.00
IGL02658:Sncaip APN 18 52894955 missense possibly damaging 0.50
IGL02737:Sncaip APN 18 52907056 missense probably benign 0.10
IGL03017:Sncaip APN 18 52894937 missense possibly damaging 0.82
PIT4445001:Sncaip UTSW 18 52868944 missense probably damaging 1.00
R0218:Sncaip UTSW 18 52907328 missense probably benign 0.18
R0325:Sncaip UTSW 18 52905809 missense probably damaging 1.00
R0450:Sncaip UTSW 18 52868709 missense probably benign 0.08
R0469:Sncaip UTSW 18 52868709 missense probably benign 0.08
R1494:Sncaip UTSW 18 52868886 missense probably damaging 0.99
R1897:Sncaip UTSW 18 52894790 splice site probably null
R1962:Sncaip UTSW 18 52871362 missense probably damaging 1.00
R2238:Sncaip UTSW 18 52868547 missense probably damaging 1.00
R2935:Sncaip UTSW 18 52838032 missense probably damaging 1.00
R4044:Sncaip UTSW 18 52907403 missense probably benign 0.01
R4694:Sncaip UTSW 18 52906557 missense probably benign 0.00
R4810:Sncaip UTSW 18 52907199 missense possibly damaging 0.47
R4850:Sncaip UTSW 18 52871384 missense probably damaging 1.00
R4857:Sncaip UTSW 18 52869225 missense probably benign 0.00
R4939:Sncaip UTSW 18 52907263 missense possibly damaging 0.53
R5384:Sncaip UTSW 18 52885041 missense probably damaging 1.00
R5610:Sncaip UTSW 18 52868919 missense probably benign
R5645:Sncaip UTSW 18 52894956 missense probably damaging 1.00
R5977:Sncaip UTSW 18 52869321 missense probably benign
R6197:Sncaip UTSW 18 52906894 missense probably damaging 1.00
R6369:Sncaip UTSW 18 52868604 missense probably damaging 0.98
R6505:Sncaip UTSW 18 52906537 nonsense probably null
R6604:Sncaip UTSW 18 52905846 missense possibly damaging 0.71
R6880:Sncaip UTSW 18 52869064 missense probably damaging 1.00
R7215:Sncaip UTSW 18 52907343 nonsense probably null
R7234:Sncaip UTSW 18 52915344 missense probably benign 0.00
Z1177:Sncaip UTSW 18 52907425 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GAGAAAATGTCTACCCAGCATTCTC -3'
(R):5'- GCTCCCAGACTCCCTTATAACTAG -3'

Sequencing Primer
(F):5'- CTTTTGGACTGGGCATGAACACAC -3'
(R):5'- CCCTTATAACTAGAATGAAGGAAGC -3'
Posted On2016-12-15