Incidental Mutation 'R5797:Scd3'
ID447303
Institutional Source Beutler Lab
Gene Symbol Scd3
Ensembl Gene ENSMUSG00000025202
Gene Namestearoyl-coenzyme A desaturase 3
Synonyms4930513N16Rik
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44203288-44244016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44215511 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 46 (I46T)
Ref Sequence ENSEMBL: ENSMUSP00000026220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026220]
Predicted Effect probably benign
Transcript: ENSMUST00000026220
AA Change: I46T

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000026220
Gene: ENSMUSG00000025202
AA Change: I46T

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
Pfam:FA_desaturase 97 316 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Scd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Scd3 APN 19 44235834 missense probably damaging 1.00
IGL00850:Scd3 APN 19 44235808 missense probably damaging 1.00
IGL02207:Scd3 APN 19 44215589 missense possibly damaging 0.60
R0054:Scd3 UTSW 19 44215637 missense probably damaging 1.00
R1820:Scd3 UTSW 19 44241806 missense probably benign 0.00
R1847:Scd3 UTSW 19 44235842 missense probably damaging 1.00
R1944:Scd3 UTSW 19 44235780 missense probably benign 0.16
R1945:Scd3 UTSW 19 44235780 missense probably benign 0.16
R3834:Scd3 UTSW 19 44241717 missense probably damaging 1.00
R4551:Scd3 UTSW 19 44215439 missense probably benign 0.00
R7921:Scd3 UTSW 19 44235892 missense possibly damaging 0.83
R7978:Scd3 UTSW 19 44234249 nonsense probably null
R8247:Scd3 UTSW 19 44238564 missense possibly damaging 0.53
X0026:Scd3 UTSW 19 44234318 missense probably benign 0.01
Z1176:Scd3 UTSW 19 44235876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTAATTAAGCCAGACCCTG -3'
(R):5'- ACTTACCGAAGAGGCAGGTG -3'

Sequencing Primer
(F):5'- GGATTGGACCTCTAATGCACCCTAG -3'
(R):5'- AGGCAGGTGTAGAGCTTGC -3'
Posted On2016-12-15