Incidental Mutation 'R5798:Ccdc169'
ID447306
Institutional Source Beutler Lab
Gene Symbol Ccdc169
Ensembl Gene ENSMUSG00000048655
Gene Namecoiled-coil domain containing 169
Synonyms
MMRRC Submission 043210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5798 (G1)
Quality Score218
Status Not validated
Chromosome3
Chromosomal Location55137339-55172935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55140124 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 12 (V12A)
Ref Sequence ENSEMBL: ENSMUSP00000054771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044116] [ENSMUST00000052904] [ENSMUST00000061099] [ENSMUST00000107971] [ENSMUST00000118118] [ENSMUST00000118963] [ENSMUST00000153009] [ENSMUST00000159904] [ENSMUST00000161120]
Predicted Effect probably benign
Transcript: ENSMUST00000044116
SMART Domains Protein: ENSMUSP00000042367
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 431 616 9.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052904
SMART Domains Protein: ENSMUSP00000049698
Gene: ENSMUSG00000048655

DomainStartEndE-ValueType
Pfam:DUF4600 1 100 2e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000061099
AA Change: V12A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054771
Gene: ENSMUSG00000048655
AA Change: V12A

DomainStartEndE-ValueType
Pfam:DUF4600 54 181 1.8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107971
SMART Domains Protein: ENSMUSP00000103605
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 9e-4 SMART
low complexity region 351 369 N/A INTRINSIC
Pfam:Senescence 373 560 3.2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118118
SMART Domains Protein: ENSMUSP00000113621
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 617 3.8e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118963
AA Change: V12A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112414
Gene: ENSMUSG00000048655
AA Change: V12A

DomainStartEndE-ValueType
Pfam:DUF4600 53 182 1.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153009
Predicted Effect probably benign
Transcript: ENSMUST00000159904
SMART Domains Protein: ENSMUSP00000123900
Gene: ENSMUSG00000048655

DomainStartEndE-ValueType
Pfam:DUF4600 1 79 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161120
SMART Domains Protein: ENSMUSP00000125131
Gene: ENSMUSG00000048655

DomainStartEndE-ValueType
Pfam:DUF4600 1 79 1.1e-32 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,306,003 Y1226* probably null Het
Ankle2 A G 5: 110,251,535 Y587C probably damaging Het
Ankrd52 T A 10: 128,387,610 M697K probably benign Het
Arhgef40 G T 14: 51,997,032 A931S probably damaging Het
Atp9a A G 2: 168,690,964 probably null Het
Ces3b T A 8: 105,088,440 C284S probably damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Ecel1 A T 1: 87,151,483 M491K probably damaging Het
Gnaz C T 10: 75,014,871 R243W probably damaging Het
Homer1 C A 13: 93,402,095 R311S probably damaging Het
Myo5c A G 9: 75,284,198 D1118G probably benign Het
Olfr116 A G 17: 37,623,990 V215A probably benign Het
Olfr676 A C 7: 105,036,137 K313T probably benign Het
Pecam1 C T 11: 106,695,832 E185K possibly damaging Het
Rfx2 A T 17: 56,804,362 V70E possibly damaging Het
Sdk2 G A 11: 113,827,116 T1474M probably damaging Het
Slc39a12 G A 2: 14,449,826 A516T probably damaging Het
Tanc2 TGCAGCAGCAGCAGCAGCAGCAGC TGCAGCAGCAGCAGCAGCAGC 11: 105,921,855 probably benign Het
Timd2 T C 11: 46,677,237 I243M probably benign Het
Vmn2r108 A T 17: 20,472,283 S104T probably benign Het
Vmn2r56 T C 7: 12,712,965 N420S probably benign Het
Zfp148 T C 16: 33,496,143 I353T probably benign Het
Other mutations in Ccdc169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ccdc169 APN 3 55171318 missense possibly damaging 0.85
IGL01662:Ccdc169 APN 3 55163311 splice site probably null
IGL02223:Ccdc169 APN 3 55142300 missense probably benign
IGL02272:Ccdc169 APN 3 55150748 missense probably damaging 0.99
IGL02329:Ccdc169 APN 3 55171281 missense probably benign
R4603:Ccdc169 UTSW 3 55150805 missense probably benign 0.01
R5347:Ccdc169 UTSW 3 55142319 splice site probably benign
R5951:Ccdc169 UTSW 3 55140141 missense probably damaging 0.99
R6562:Ccdc169 UTSW 3 55150814 missense probably damaging 0.98
R7599:Ccdc169 UTSW 3 55140109 missense probably damaging 0.99
X0011:Ccdc169 UTSW 3 55157082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTGTAGACATGAGCAAC -3'
(R):5'- GCACGACAACTCTTGTATTCCC -3'

Sequencing Primer
(F):5'- TGTAGACATGAGCAACACCCTATG -3'
(R):5'- GTAACTCCAATTCCAGGGGATCTG -3'
Posted On2016-12-15