Incidental Mutation 'R5798:Pecam1'
ID447318
Institutional Source Beutler Lab
Gene Symbol Pecam1
Ensembl Gene ENSMUSG00000020717
Gene Nameplatelet/endothelial cell adhesion molecule 1
SynonymsCd31, PECAM-1
MMRRC Submission 043210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5798 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106654217-106750628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106695832 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 185 (E185K)
Ref Sequence ENSEMBL: ENSMUSP00000138959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068021] [ENSMUST00000080853] [ENSMUST00000103069] [ENSMUST00000106796] [ENSMUST00000124958] [ENSMUST00000183610]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068021
AA Change: E286K

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000067111
Gene: ENSMUSG00000020717
AA Change: E286K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
Pfam:Ig_3 122 198 4.2e-4 PFAM
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 718 1e-10 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000080853
AA Change: E286K

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079664
Gene: ENSMUSG00000020717
AA Change: E286K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 710 4e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000103069
AA Change: E286K

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099358
Gene: ENSMUSG00000020717
AA Change: E286K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106796
AA Change: E286K

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102408
Gene: ENSMUSG00000020717
AA Change: E286K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 727 1e-16 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000124958
AA Change: E258K

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122414
Gene: ENSMUSG00000020717
AA Change: E258K

DomainStartEndE-ValueType
IG 4 90 1.5e-6 SMART
Pfam:Ig_2 94 191 2.9e-1 PFAM
IG_like 202 283 5.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135481
Predicted Effect possibly damaging
Transcript: ENSMUST00000183610
AA Change: E185K

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138959
Gene: ENSMUSG00000020717
AA Change: E185K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 129 210 1.38e2 SMART
IG_like 226 281 2e-1 SMART
Blast:IG_like 304 385 2e-31 BLAST
IG 396 483 5.49e-1 SMART
transmembrane domain 491 513 N/A INTRINSIC
PDB:2KY5|A 575 626 1e-16 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found on the surface of platelets, monocytes, neutrophils, and some types of T-cells, and makes up a large portion of endothelial cell intercellular junctions. The encoded protein is a member of the immunoglobulin superfamily and is likely involved in leukocyte migration, angiogenesis, and integrin activation. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show increased susceptibility to collagen-induced arthritis, impaired lung alveolarization, and enhanced susceptibility to endotoxic shock. Mice homozygous for a gene-trapped allele show altered vasodilation and nitric oxide homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,306,003 Y1226* probably null Het
Ankle2 A G 5: 110,251,535 Y587C probably damaging Het
Ankrd52 T A 10: 128,387,610 M697K probably benign Het
Arhgef40 G T 14: 51,997,032 A931S probably damaging Het
Atp9a A G 2: 168,690,964 probably null Het
Ccdc169 T C 3: 55,140,124 V12A possibly damaging Het
Ces3b T A 8: 105,088,440 C284S probably damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Ecel1 A T 1: 87,151,483 M491K probably damaging Het
Gnaz C T 10: 75,014,871 R243W probably damaging Het
Homer1 C A 13: 93,402,095 R311S probably damaging Het
Myo5c A G 9: 75,284,198 D1118G probably benign Het
Olfr116 A G 17: 37,623,990 V215A probably benign Het
Olfr676 A C 7: 105,036,137 K313T probably benign Het
Rfx2 A T 17: 56,804,362 V70E possibly damaging Het
Sdk2 G A 11: 113,827,116 T1474M probably damaging Het
Slc39a12 G A 2: 14,449,826 A516T probably damaging Het
Tanc2 TGCAGCAGCAGCAGCAGCAGCAGC TGCAGCAGCAGCAGCAGCAGC 11: 105,921,855 probably benign Het
Timd2 T C 11: 46,677,237 I243M probably benign Het
Vmn2r108 A T 17: 20,472,283 S104T probably benign Het
Vmn2r56 T C 7: 12,712,965 N420S probably benign Het
Zfp148 T C 16: 33,496,143 I353T probably benign Het
Other mutations in Pecam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Pecam1 APN 11 106699798 missense probably damaging 1.00
IGL01914:Pecam1 APN 11 106699867 missense possibly damaging 0.95
IGL02035:Pecam1 APN 11 106695859 missense probably benign 0.43
IGL02124:Pecam1 APN 11 106690981 missense probably damaging 0.98
IGL02487:Pecam1 APN 11 106671780 missense probably damaging 1.00
IGL02576:Pecam1 APN 11 106671774 missense probably damaging 1.00
IGL03101:Pecam1 APN 11 106697351 missense probably damaging 0.99
R1495:Pecam1 UTSW 11 106688856 missense probably damaging 0.96
R1614:Pecam1 UTSW 11 106681079 missense probably benign 0.00
R1628:Pecam1 UTSW 11 106682960 splice site probably null
R1950:Pecam1 UTSW 11 106685203 missense probably damaging 1.00
R1994:Pecam1 UTSW 11 106695937 missense possibly damaging 0.95
R3149:Pecam1 UTSW 11 106684281 missense possibly damaging 0.53
R4022:Pecam1 UTSW 11 106655160 missense probably benign 0.00
R4418:Pecam1 UTSW 11 106695922 missense possibly damaging 0.61
R4747:Pecam1 UTSW 11 106684246 missense probably benign 0.29
R4828:Pecam1 UTSW 11 106699808 missense probably damaging 1.00
R5864:Pecam1 UTSW 11 106684250 nonsense probably null
R5942:Pecam1 UTSW 11 106661983 intron probably benign
R5966:Pecam1 UTSW 11 106691061 missense probably benign 0.44
R6285:Pecam1 UTSW 11 106685239 missense probably benign 0.02
R6519:Pecam1 UTSW 11 106699642 missense probably benign 0.01
R7078:Pecam1 UTSW 11 106688947 missense probably benign 0.06
R7135:Pecam1 UTSW 11 106689031 missense probably damaging 0.99
R7215:Pecam1 UTSW 11 106695919 missense probably benign 0.15
R7574:Pecam1 UTSW 11 106699784 missense probably damaging 1.00
R7795:Pecam1 UTSW 11 106695832 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGGCATCACACTCACTGG -3'
(R):5'- TCCCAAGTTTGAAATCAAGCCC -3'

Sequencing Primer
(F):5'- CACTGGTCAGGGTCTCACTAGATAG -3'
(R):5'- GTTTGAAATCAAGCCCCCTGG -3'
Posted On2016-12-15