Incidental Mutation 'R5798:Olfr116'
ID447325
Institutional Source Beutler Lab
Gene Symbol Olfr116
Ensembl Gene ENSMUSG00000061336
Gene Nameolfactory receptor 116
SynonymsMOR218-2, GA_x6K02T2PSCP-2084102-2083137
MMRRC Submission 043210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5798 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37620577-37627199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37623990 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 215 (V215A)
Ref Sequence ENSEMBL: ENSMUSP00000150977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072265] [ENSMUST00000216128] [ENSMUST00000223366]
Predicted Effect probably benign
Transcript: ENSMUST00000072265
AA Change: V215A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072115
Gene: ENSMUSG00000061336
AA Change: V215A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-6 PFAM
Pfam:7tm_1 41 290 6.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216128
AA Change: V215A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000223366
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,306,003 Y1226* probably null Het
Ankle2 A G 5: 110,251,535 Y587C probably damaging Het
Ankrd52 T A 10: 128,387,610 M697K probably benign Het
Arhgef40 G T 14: 51,997,032 A931S probably damaging Het
Atp9a A G 2: 168,690,964 probably null Het
Ccdc169 T C 3: 55,140,124 V12A possibly damaging Het
Ces3b T A 8: 105,088,440 C284S probably damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Ecel1 A T 1: 87,151,483 M491K probably damaging Het
Gnaz C T 10: 75,014,871 R243W probably damaging Het
Homer1 C A 13: 93,402,095 R311S probably damaging Het
Myo5c A G 9: 75,284,198 D1118G probably benign Het
Olfr676 A C 7: 105,036,137 K313T probably benign Het
Pecam1 C T 11: 106,695,832 E185K possibly damaging Het
Rfx2 A T 17: 56,804,362 V70E possibly damaging Het
Sdk2 G A 11: 113,827,116 T1474M probably damaging Het
Slc39a12 G A 2: 14,449,826 A516T probably damaging Het
Tanc2 TGCAGCAGCAGCAGCAGCAGCAGC TGCAGCAGCAGCAGCAGCAGC 11: 105,921,855 probably benign Het
Timd2 T C 11: 46,677,237 I243M probably benign Het
Vmn2r108 A T 17: 20,472,283 S104T probably benign Het
Vmn2r56 T C 7: 12,712,965 N420S probably benign Het
Zfp148 T C 16: 33,496,143 I353T probably benign Het
Other mutations in Olfr116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02434:Olfr116 APN 17 37624576 missense possibly damaging 0.86
IGL02639:Olfr116 APN 17 37623987 missense probably benign 0.01
IGL02663:Olfr116 APN 17 37624044 missense probably benign 0.37
R0049:Olfr116 UTSW 17 37624133 missense probably benign 0.02
R1260:Olfr116 UTSW 17 37623703 missense probably benign 0.00
R1531:Olfr116 UTSW 17 37624352 nonsense probably null
R3236:Olfr116 UTSW 17 37624236 missense possibly damaging 0.65
R4083:Olfr116 UTSW 17 37624425 missense probably damaging 1.00
R4308:Olfr116 UTSW 17 37623736 missense possibly damaging 0.46
R4887:Olfr116 UTSW 17 37623891 missense probably damaging 0.99
R5167:Olfr116 UTSW 17 37623751 nonsense probably null
R5323:Olfr116 UTSW 17 37624155 missense probably benign 0.22
R5496:Olfr116 UTSW 17 37624578 missense probably benign 0.01
R5530:Olfr116 UTSW 17 37623807 missense possibly damaging 0.72
R5643:Olfr116 UTSW 17 37624432 missense probably benign 0.00
R5644:Olfr116 UTSW 17 37624432 missense probably benign 0.00
R6020:Olfr116 UTSW 17 37623967 missense possibly damaging 0.94
R7058:Olfr116 UTSW 17 37623706 missense probably benign 0.00
R7453:Olfr116 UTSW 17 37624385 missense probably benign 0.00
R7474:Olfr116 UTSW 17 37624386 missense probably benign 0.30
R7565:Olfr116 UTSW 17 37624501 missense probably damaging 0.99
R7646:Olfr116 UTSW 17 37624404 missense probably damaging 1.00
Z1088:Olfr116 UTSW 17 37624429 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTAAAGCAGTTGGAGAGTCTG -3'
(R):5'- GTCCCAGAAAGTGTACGTGG -3'

Sequencing Primer
(F):5'- CTGAGCTTGTGTTTAGATATGCACAG -3'
(R):5'- TGGCTAAGCAGTGTAATTCCAG -3'
Posted On2016-12-15