Incidental Mutation 'R5800:Efhc1'
ID447328
Institutional Source Beutler Lab
Gene Symbol Efhc1
Ensembl Gene ENSMUSG00000041809
Gene NameEF-hand domain (C-terminal) containing 1
SynonymsmRib72-1, myoclonin1, 1700029F22Rik
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20951626-20990841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20978781 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 473 (V473I)
Ref Sequence ENSEMBL: ENSMUSP00000042343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038447]
Predicted Effect probably benign
Transcript: ENSMUST00000038447
AA Change: V473I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000042343
Gene: ENSMUSG00000041809
AA Change: V473I

DomainStartEndE-ValueType
DM10 93 198 2.74e-52 SMART
DM10 239 359 3.04e-59 SMART
DM10 416 520 8.05e-50 SMART
SCOP:d1sra__ 538 646 2e-12 SMART
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an EF-hand-containing calcium binding protein. The encoded protein likely plays a role in calcium homeostasis. Mutations in this gene have been associated with susceptibility to juvenile myoclonic epilepsy and juvenile absence epilepsy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display myoclonus and increased susceptibility to pharmacologically induced seizures. Homozygous mice also display enlarged brain ventricles and reduced hippocampal size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Efhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Efhc1 APN 1 20979481 nonsense probably null
IGL00549:Efhc1 APN 1 20979481 nonsense probably null
IGL01611:Efhc1 APN 1 20990687 makesense probably null
IGL01916:Efhc1 APN 1 20978749 missense probably damaging 1.00
IGL02366:Efhc1 APN 1 20960262 missense probably damaging 0.99
IGL02567:Efhc1 APN 1 20972964 missense probably damaging 0.98
IGL02590:Efhc1 APN 1 20967384 missense probably damaging 1.00
IGL02869:Efhc1 APN 1 20967343 missense probably damaging 0.96
IGL03264:Efhc1 APN 1 20967491 missense probably benign
IGL03292:Efhc1 APN 1 20960272 missense possibly damaging 0.89
IGL03097:Efhc1 UTSW 1 20972825 missense probably damaging 1.00
P0023:Efhc1 UTSW 1 20955527 missense probably benign
R0180:Efhc1 UTSW 1 20967489 missense probably benign
R0220:Efhc1 UTSW 1 20967358 missense probably damaging 0.98
R0391:Efhc1 UTSW 1 20960188 missense probably damaging 1.00
R0765:Efhc1 UTSW 1 20978652 missense probably benign 0.00
R1293:Efhc1 UTSW 1 20978772 missense probably damaging 0.96
R1414:Efhc1 UTSW 1 20961289 missense probably damaging 1.00
R1644:Efhc1 UTSW 1 20967401 nonsense probably null
R1799:Efhc1 UTSW 1 20979538 missense probably benign 0.00
R1932:Efhc1 UTSW 1 20967400 missense probably damaging 1.00
R1991:Efhc1 UTSW 1 20989560 nonsense probably null
R2103:Efhc1 UTSW 1 20989560 nonsense probably null
R3956:Efhc1 UTSW 1 20978666 missense probably damaging 0.96
R4812:Efhc1 UTSW 1 20990647 missense probably damaging 0.99
R5064:Efhc1 UTSW 1 20974963 missense possibly damaging 0.91
R5562:Efhc1 UTSW 1 20972880 missense probably damaging 0.98
R5948:Efhc1 UTSW 1 20972828 missense probably damaging 0.99
R5977:Efhc1 UTSW 1 20960218 missense probably damaging 1.00
R6313:Efhc1 UTSW 1 20979428 missense possibly damaging 0.69
R6375:Efhc1 UTSW 1 20972940 missense probably benign 0.05
R6512:Efhc1 UTSW 1 20960349 missense probably damaging 0.99
R6530:Efhc1 UTSW 1 20961142 splice site probably null
R6865:Efhc1 UTSW 1 20960218 missense probably damaging 1.00
R7398:Efhc1 UTSW 1 20989520 missense probably benign
R7656:Efhc1 UTSW 1 20961057 splice site probably null
R7676:Efhc1 UTSW 1 20967369 missense probably damaging 1.00
R7719:Efhc1 UTSW 1 20979520 missense probably benign
R7775:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7778:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7824:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7857:Efhc1 UTSW 1 20975002 missense probably benign 0.11
R7970:Efhc1 UTSW 1 20951795 missense probably benign 0.12
R8187:Efhc1 UTSW 1 20960172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGACCCTCAATACATGG -3'
(R):5'- ACAGTCAACTACCTCTTATAAGGC -3'

Sequencing Primer
(F):5'- CATTTGGCGTCCTAGAAAGATC -3'
(R):5'- CTTAAGAATGCAGTGTGTCACAGC -3'
Posted On2016-12-15