Incidental Mutation 'R5800:Lyg1'
ID447329
Institutional Source Beutler Lab
Gene Symbol Lyg1
Ensembl Gene ENSMUSG00000026085
Gene Namelysozyme G-like 1
Synonyms
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37946736-37957759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37946953 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 176 (D176N)
Ref Sequence ENSEMBL: ENSMUSP00000110544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027254] [ENSMUST00000114894]
Predicted Effect probably damaging
Transcript: ENSMUST00000027254
AA Change: D176N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027254
Gene: ENSMUSG00000026085
AA Change: D176N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d153l__ 23 197 1e-47 SMART
PDB:154L|A 24 197 2e-48 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114894
AA Change: D176N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110544
Gene: ENSMUSG00000026085
AA Change: D176N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d153l__ 23 197 8e-48 SMART
PDB:154L|A 24 197 1e-48 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144184
Meta Mutation Damage Score 0.2625 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Lyg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Lyg1 APN 1 37949930 missense probably damaging 1.00
IGL03095:Lyg1 APN 1 37950768 splice site probably benign
R0411:Lyg1 UTSW 1 37949896 missense possibly damaging 0.92
R1171:Lyg1 UTSW 1 37947224 missense probably damaging 1.00
R2126:Lyg1 UTSW 1 37950674 missense probably damaging 0.96
R3715:Lyg1 UTSW 1 37950678 missense probably damaging 0.96
R3744:Lyg1 UTSW 1 37949842 missense probably benign 0.37
R4660:Lyg1 UTSW 1 37946861 utr 3 prime probably benign
R5040:Lyg1 UTSW 1 37950811 intron probably benign
R5769:Lyg1 UTSW 1 37950750 missense unknown
R5792:Lyg1 UTSW 1 37947267 missense probably benign 0.00
R7318:Lyg1 UTSW 1 37949855 missense probably benign 0.44
R8323:Lyg1 UTSW 1 37949937 missense probably damaging 0.99
Z1176:Lyg1 UTSW 1 37947177 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTTCAGATCCAACTCAGATG -3'
(R):5'- ACGTGTTCCACTGTTGGCTG -3'

Sequencing Primer
(F):5'- GATCCAACTCAGATGTGCGACTG -3'
(R):5'- TGCTTCACAGCCCGGAAGTAAG -3'
Posted On2016-12-15