Incidental Mutation 'R5800:Tbc1d20'
ID 447333
Institutional Source Beutler Lab
Gene Symbol Tbc1d20
Ensembl Gene ENSMUSG00000027465
Gene Name TBC1 domain family, member 20
Synonyms bs, 1110028I04Rik, 2810442O16Rik
MMRRC Submission 043389-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.289) question?
Stock # R5800 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 152135748-152155916 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 152150245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028963] [ENSMUST00000144252] [ENSMUST00000147591]
AlphaFold Q9D9I4
Predicted Effect probably null
Transcript: ENSMUST00000028963
SMART Domains Protein: ENSMUSP00000028963
Gene: ENSMUSG00000027465

DomainStartEndE-ValueType
TBC 56 268 6.19e-5 SMART
low complexity region 304 323 N/A INTRINSIC
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141373
Predicted Effect probably benign
Transcript: ENSMUST00000144252
SMART Domains Protein: ENSMUSP00000122542
Gene: ENSMUSG00000027465

DomainStartEndE-ValueType
Pfam:RabGAP-TBC 8 80 5.3e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147591
SMART Domains Protein: ENSMUSP00000119209
Gene: ENSMUSG00000027465

DomainStartEndE-ValueType
Pfam:RabGAP-TBC 11 155 2e-24 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of GTPase activator proteins of Rab-like small GTPases. The encoded protein and its cognate GTPase, Rab1, bind the nonstructural protein 5A (NS5A) of the hepatitis C virus (HCV) to mediate viral replication. Depletion of this protein inhibits replication of the virus and HCV infection. Mutations in this gene are associated with Warburg micro syndrome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous mutants have bilateral cataracts, small eyes, glossy coats, and are male sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,360,591 (GRCm39) V540D possibly damaging Het
Adamts8 A T 9: 30,865,778 (GRCm39) D442V probably damaging Het
B3galt9 T C 2: 34,728,654 (GRCm39) F151S possibly damaging Het
Bltp1 A G 3: 37,106,592 (GRCm39) D4974G probably damaging Het
Casp4 G A 9: 5,308,915 (GRCm39) probably null Het
Cfap45 T A 1: 172,366,167 (GRCm39) V30E probably damaging Het
Col6a4 A G 9: 105,957,474 (GRCm39) F117L probably damaging Het
Dnah7c A T 1: 46,686,175 (GRCm39) T1810S probably benign Het
Drosha C T 15: 12,865,153 (GRCm39) T627M probably damaging Het
Drosha C A 15: 12,902,733 (GRCm39) A1001D probably damaging Het
Efhc1 G A 1: 21,049,005 (GRCm39) V473I probably benign Het
Ephx2 T C 14: 66,344,751 (GRCm39) K191R probably benign Het
Ero1b T A 13: 12,617,190 (GRCm39) probably null Het
Esyt2 A T 12: 116,333,808 (GRCm39) D837V possibly damaging Het
Fip1l1 T A 5: 74,706,742 (GRCm39) D126E possibly damaging Het
Fyttd1 C T 16: 32,711,658 (GRCm39) R86C probably damaging Het
Gm12888 T A 4: 121,176,625 (GRCm39) T59S probably damaging Het
Gm7353 A T 7: 3,160,168 (GRCm39) noncoding transcript Het
Gpr153 C T 4: 152,364,534 (GRCm39) Q197* probably null Het
Grep1 G A 17: 23,936,966 (GRCm39) P72S probably damaging Het
H2-T23 G T 17: 36,342,496 (GRCm39) probably benign Het
Ighv1-16 T A 12: 114,629,531 (GRCm39) R85S probably benign Het
Ipcef1 T A 10: 6,840,569 (GRCm39) D376V probably damaging Het
Kdm1a T A 4: 136,300,381 (GRCm39) probably null Het
Klk1b27 A T 7: 43,705,088 (GRCm39) Q85L probably benign Het
Krt39 A T 11: 99,411,971 (GRCm39) D38E probably benign Het
L1td1 T C 4: 98,621,999 (GRCm39) L187P possibly damaging Het
Lrrc8b C T 5: 105,629,208 (GRCm39) S518L probably benign Het
Lyg1 C T 1: 37,986,034 (GRCm39) D176N probably damaging Het
Mctp1 A G 13: 76,836,678 (GRCm39) N82D probably damaging Het
Muc6 T C 7: 141,226,690 (GRCm39) probably benign Het
Nynrin T C 14: 56,108,088 (GRCm39) L1065P probably damaging Het
Or5b118 T C 19: 13,449,260 (GRCm39) S309P probably benign Het
Pcdh7 T A 5: 57,879,567 (GRCm39) S1041T probably damaging Het
Pkd1l1 T A 11: 8,811,302 (GRCm39) M1518L probably benign Het
Prl8a6 G T 13: 27,619,453 (GRCm39) Q90K probably benign Het
Ptcd1 T A 5: 145,096,475 (GRCm39) D206V probably damaging Het
Rap1gap C A 4: 137,447,688 (GRCm39) D478E probably benign Het
Scn5a A G 9: 119,330,732 (GRCm39) Y1269H probably damaging Het
Sdc2 A T 15: 33,028,290 (GRCm39) H136L probably benign Het
Senp6 A T 9: 80,033,715 (GRCm39) I120F probably damaging Het
Shisa5 G A 9: 108,885,162 (GRCm39) probably null Het
Slc19a1 A G 10: 76,878,103 (GRCm39) S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 (GRCm39) probably benign Het
Tll2 T C 19: 41,093,373 (GRCm39) H481R probably benign Het
Tmc7 A G 7: 118,138,663 (GRCm39) V692A probably benign Het
Tmem234 T C 4: 129,500,924 (GRCm39) probably null Het
Vmn1r237 C G 17: 21,535,069 (GRCm39) T264S probably benign Het
Vmn2r98 A T 17: 19,286,260 (GRCm39) T253S probably benign Het
Zfyve27 T C 19: 42,171,102 (GRCm39) Y191H probably damaging Het
Other mutations in Tbc1d20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02055:Tbc1d20 APN 2 152,149,978 (GRCm39) missense probably damaging 0.99
IGL03111:Tbc1d20 APN 2 152,149,998 (GRCm39) missense probably damaging 1.00
R0014:Tbc1d20 UTSW 2 152,153,701 (GRCm39) missense probably benign 0.34
R2484:Tbc1d20 UTSW 2 152,153,283 (GRCm39) missense probably damaging 1.00
R3683:Tbc1d20 UTSW 2 152,153,737 (GRCm39) missense probably benign 0.05
R4352:Tbc1d20 UTSW 2 152,150,114 (GRCm39) intron probably benign
R4815:Tbc1d20 UTSW 2 152,153,909 (GRCm39) unclassified probably benign
R4908:Tbc1d20 UTSW 2 152,144,228 (GRCm39) missense probably benign 0.08
R5010:Tbc1d20 UTSW 2 152,135,856 (GRCm39) unclassified probably benign
R5635:Tbc1d20 UTSW 2 152,153,381 (GRCm39) missense probably benign 0.18
R5832:Tbc1d20 UTSW 2 152,153,282 (GRCm39) missense possibly damaging 0.93
R7193:Tbc1d20 UTSW 2 152,153,337 (GRCm39) missense probably benign 0.01
R7346:Tbc1d20 UTSW 2 152,146,881 (GRCm39) missense probably benign 0.02
R7705:Tbc1d20 UTSW 2 152,150,004 (GRCm39) missense probably damaging 1.00
R9289:Tbc1d20 UTSW 2 152,153,262 (GRCm39) missense probably damaging 1.00
Z1177:Tbc1d20 UTSW 2 152,150,013 (GRCm39) missense probably damaging 1.00
Z1177:Tbc1d20 UTSW 2 152,149,928 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGGTCACATTTCTGCTGG -3'
(R):5'- CTGAGCTGTATCCCTACATGC -3'

Sequencing Primer
(F):5'- TCCCTGGTAGAAAAATTGTCTACCC -3'
(R):5'- CCCTACATGCTAGATTTGTGAAG -3'
Posted On 2016-12-15