Incidental Mutation 'R5800:Tbc1d20'
ID447333
Institutional Source Beutler Lab
Gene Symbol Tbc1d20
Ensembl Gene ENSMUSG00000027465
Gene NameTBC1 domain family, member 20
Synonyms
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152293828-152313996 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 152308325 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028963] [ENSMUST00000144252] [ENSMUST00000147591]
Predicted Effect probably null
Transcript: ENSMUST00000028963
SMART Domains Protein: ENSMUSP00000028963
Gene: ENSMUSG00000027465

DomainStartEndE-ValueType
TBC 56 268 6.19e-5 SMART
low complexity region 304 323 N/A INTRINSIC
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141373
Predicted Effect probably benign
Transcript: ENSMUST00000144252
SMART Domains Protein: ENSMUSP00000122542
Gene: ENSMUSG00000027465

DomainStartEndE-ValueType
Pfam:RabGAP-TBC 8 80 5.3e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147591
SMART Domains Protein: ENSMUSP00000119209
Gene: ENSMUSG00000027465

DomainStartEndE-ValueType
Pfam:RabGAP-TBC 11 155 2e-24 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of GTPase activator proteins of Rab-like small GTPases. The encoded protein and its cognate GTPase, Rab1, bind the nonstructural protein 5A (NS5A) of the hepatitis C virus (HCV) to mediate viral replication. Depletion of this protein inhibits replication of the virus and HCV infection. Mutations in this gene are associated with Warburg micro syndrome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous mutants have bilateral cataracts, small eyes, glossy coats, and are male sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Tbc1d20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02055:Tbc1d20 APN 2 152308058 missense probably damaging 0.99
IGL03111:Tbc1d20 APN 2 152308078 missense probably damaging 1.00
R0014:Tbc1d20 UTSW 2 152311781 missense probably benign 0.34
R2484:Tbc1d20 UTSW 2 152311363 missense probably damaging 1.00
R3683:Tbc1d20 UTSW 2 152311817 missense probably benign 0.05
R4352:Tbc1d20 UTSW 2 152308194 intron probably benign
R4815:Tbc1d20 UTSW 2 152311989 unclassified probably benign
R4908:Tbc1d20 UTSW 2 152302308 missense probably benign 0.08
R5010:Tbc1d20 UTSW 2 152293936 unclassified probably benign
R5635:Tbc1d20 UTSW 2 152311461 missense probably benign 0.18
R5832:Tbc1d20 UTSW 2 152311362 missense possibly damaging 0.93
R7193:Tbc1d20 UTSW 2 152311417 missense probably benign 0.01
R7346:Tbc1d20 UTSW 2 152304961 missense probably benign 0.02
R7705:Tbc1d20 UTSW 2 152308084 missense probably damaging 1.00
Z1177:Tbc1d20 UTSW 2 152308008 missense probably damaging 1.00
Z1177:Tbc1d20 UTSW 2 152308093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGGTCACATTTCTGCTGG -3'
(R):5'- CTGAGCTGTATCCCTACATGC -3'

Sequencing Primer
(F):5'- TCCCTGGTAGAAAAATTGTCTACCC -3'
(R):5'- CCCTACATGCTAGATTTGTGAAG -3'
Posted On2016-12-15