Incidental Mutation 'R5800:Tmem234'
ID447338
Institutional Source Beutler Lab
Gene Symbol Tmem234
Ensembl Gene ENSMUSG00000028797
Gene Nametransmembrane protein 234
Synonyms
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129600668-129624059 bp(+) (GRCm38)
Type of Mutationsplice site (1200 bp from exon)
DNA Base Change (assembly) T to C at 129607131 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102591] [ENSMUST00000106037] [ENSMUST00000129515] [ENSMUST00000135628] [ENSMUST00000137090] [ENSMUST00000150110] [ENSMUST00000151969] [ENSMUST00000152126] [ENSMUST00000173758] [ENSMUST00000181579] [ENSMUST00000173937] [ENSMUST00000174073] [ENSMUST00000172774] [ENSMUST00000179209] [ENSMUST00000174819]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102591
AA Change: F94L

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099651
Gene: ENSMUSG00000028797
AA Change: F94L

DomainStartEndE-ValueType
Pfam:TMEM234 11 126 2.1e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106037
SMART Domains Protein: ENSMUSP00000101653
Gene: ENSMUSG00000078552

DomainStartEndE-ValueType
DCX 1 85 7.69e-26 SMART
DCX 118 205 6.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129515
SMART Domains Protein: ENSMUSP00000117184
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135628
SMART Domains Protein: ENSMUSP00000120682
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137090
SMART Domains Protein: ENSMUSP00000117568
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144304
Predicted Effect probably benign
Transcript: ENSMUST00000145345
SMART Domains Protein: ENSMUSP00000122893
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:TMEM234 6 56 2.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150110
SMART Domains Protein: ENSMUSP00000122513
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 58 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151969
SMART Domains Protein: ENSMUSP00000120878
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152126
SMART Domains Protein: ENSMUSP00000120224
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172635
Predicted Effect possibly damaging
Transcript: ENSMUST00000173758
AA Change: F85L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134588
Gene: ENSMUSG00000028797
AA Change: F85L

DomainStartEndE-ValueType
Pfam:UPF0546 11 117 3.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181579
AA Change: F94L

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137989
Gene: ENSMUSG00000028797
AA Change: F94L

DomainStartEndE-ValueType
Pfam:UPF0546 11 124 4.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174350
Predicted Effect probably benign
Transcript: ENSMUST00000173937
SMART Domains Protein: ENSMUSP00000133412
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174073
SMART Domains Protein: ENSMUSP00000133325
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172774
SMART Domains Protein: ENSMUSP00000133502
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179209
SMART Domains Protein: ENSMUSP00000135913
Gene: ENSMUSG00000078552

DomainStartEndE-ValueType
DCX 1 86 1.32e-24 SMART
DCX 91 178 1.1e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174819
SMART Domains Protein: ENSMUSP00000133695
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 57 1.5e-12 PFAM
Meta Mutation Damage Score 0.3801 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibited an increased median serum IgG2a response to ovalbumin challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Tmem234
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02640:Tmem234 APN 4 129601103 missense probably damaging 0.98
R5108:Tmem234 UTSW 4 129601937 intron probably benign
R5367:Tmem234 UTSW 4 129600707 start gained probably benign
R6651:Tmem234 UTSW 4 129607471 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCATCTGCTTCATGTGTCATAG -3'
(R):5'- CCAGATTGCTCAGGGAAAGG -3'

Sequencing Primer
(F):5'- TCTACAGAGTGAGTTCCAGGAC -3'
(R):5'- TTGCTCAGGGAAAGGAGACTGC -3'
Posted On2016-12-15