Incidental Mutation 'R5800:Pcdh7'
ID 447342
Institutional Source Beutler Lab
Gene Symbol Pcdh7
Ensembl Gene ENSMUSG00000029108
Gene Name protocadherin 7
Synonyms BH-protocadherin
MMRRC Submission 043389-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R5800 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 57875309-58290572 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57879567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1041 (S1041T)
Ref Sequence ENSEMBL: ENSMUSP00000142319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068110] [ENSMUST00000094783] [ENSMUST00000191837] [ENSMUST00000199310]
AlphaFold A0A0A6YY83
Predicted Effect probably damaging
Transcript: ENSMUST00000068110
AA Change: S1041T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066306
Gene: ENSMUSG00000029108
AA Change: S1041T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000094783
AA Change: S1041T
SMART Domains Protein: ENSMUSP00000092376
Gene: ENSMUSG00000029108
AA Change: S1041T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180708
Predicted Effect probably damaging
Transcript: ENSMUST00000191837
AA Change: S1041T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142319
Gene: ENSMUSG00000029108
AA Change: S1041T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000192048
AA Change: S6T
Predicted Effect unknown
Transcript: ENSMUST00000192287
AA Change: S701T
Predicted Effect probably damaging
Transcript: ENSMUST00000199310
AA Change: S65T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143387
Gene: ENSMUSG00000029108
AA Change: S65T

DomainStartEndE-ValueType
Pfam:Protocadherin 1 79 5.1e-40 PFAM
low complexity region 112 123 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000195156
AA Change: S355T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200266
Meta Mutation Damage Score 0.1904 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a protein with an extracellular domain containing 7 cadherin repeats. The gene product is an integral membrane protein that is thought to function in cell-cell recognition and adhesion. Alternative splicing yields isoforms with unique cytoplasmic tails. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,360,591 (GRCm39) V540D possibly damaging Het
Adamts8 A T 9: 30,865,778 (GRCm39) D442V probably damaging Het
B3galt9 T C 2: 34,728,654 (GRCm39) F151S possibly damaging Het
Bltp1 A G 3: 37,106,592 (GRCm39) D4974G probably damaging Het
Casp4 G A 9: 5,308,915 (GRCm39) probably null Het
Cfap45 T A 1: 172,366,167 (GRCm39) V30E probably damaging Het
Col6a4 A G 9: 105,957,474 (GRCm39) F117L probably damaging Het
Dnah7c A T 1: 46,686,175 (GRCm39) T1810S probably benign Het
Drosha C T 15: 12,865,153 (GRCm39) T627M probably damaging Het
Drosha C A 15: 12,902,733 (GRCm39) A1001D probably damaging Het
Efhc1 G A 1: 21,049,005 (GRCm39) V473I probably benign Het
Ephx2 T C 14: 66,344,751 (GRCm39) K191R probably benign Het
Ero1b T A 13: 12,617,190 (GRCm39) probably null Het
Esyt2 A T 12: 116,333,808 (GRCm39) D837V possibly damaging Het
Fip1l1 T A 5: 74,706,742 (GRCm39) D126E possibly damaging Het
Fyttd1 C T 16: 32,711,658 (GRCm39) R86C probably damaging Het
Gm12888 T A 4: 121,176,625 (GRCm39) T59S probably damaging Het
Gm7353 A T 7: 3,160,168 (GRCm39) noncoding transcript Het
Gpr153 C T 4: 152,364,534 (GRCm39) Q197* probably null Het
Grep1 G A 17: 23,936,966 (GRCm39) P72S probably damaging Het
H2-T23 G T 17: 36,342,496 (GRCm39) probably benign Het
Ighv1-16 T A 12: 114,629,531 (GRCm39) R85S probably benign Het
Ipcef1 T A 10: 6,840,569 (GRCm39) D376V probably damaging Het
Kdm1a T A 4: 136,300,381 (GRCm39) probably null Het
Klk1b27 A T 7: 43,705,088 (GRCm39) Q85L probably benign Het
Krt39 A T 11: 99,411,971 (GRCm39) D38E probably benign Het
L1td1 T C 4: 98,621,999 (GRCm39) L187P possibly damaging Het
Lrrc8b C T 5: 105,629,208 (GRCm39) S518L probably benign Het
Lyg1 C T 1: 37,986,034 (GRCm39) D176N probably damaging Het
Mctp1 A G 13: 76,836,678 (GRCm39) N82D probably damaging Het
Muc6 T C 7: 141,226,690 (GRCm39) probably benign Het
Nynrin T C 14: 56,108,088 (GRCm39) L1065P probably damaging Het
Or5b118 T C 19: 13,449,260 (GRCm39) S309P probably benign Het
Pkd1l1 T A 11: 8,811,302 (GRCm39) M1518L probably benign Het
Prl8a6 G T 13: 27,619,453 (GRCm39) Q90K probably benign Het
Ptcd1 T A 5: 145,096,475 (GRCm39) D206V probably damaging Het
Rap1gap C A 4: 137,447,688 (GRCm39) D478E probably benign Het
Scn5a A G 9: 119,330,732 (GRCm39) Y1269H probably damaging Het
Sdc2 A T 15: 33,028,290 (GRCm39) H136L probably benign Het
Senp6 A T 9: 80,033,715 (GRCm39) I120F probably damaging Het
Shisa5 G A 9: 108,885,162 (GRCm39) probably null Het
Slc19a1 A G 10: 76,878,103 (GRCm39) S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 (GRCm39) probably benign Het
Tbc1d20 T A 2: 152,150,245 (GRCm39) probably null Het
Tll2 T C 19: 41,093,373 (GRCm39) H481R probably benign Het
Tmc7 A G 7: 118,138,663 (GRCm39) V692A probably benign Het
Tmem234 T C 4: 129,500,924 (GRCm39) probably null Het
Vmn1r237 C G 17: 21,535,069 (GRCm39) T264S probably benign Het
Vmn2r98 A T 17: 19,286,260 (GRCm39) T253S probably benign Het
Zfyve27 T C 19: 42,171,102 (GRCm39) Y191H probably damaging Het
Other mutations in Pcdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Pcdh7 APN 5 57,878,806 (GRCm39) missense probably damaging 1.00
IGL00920:Pcdh7 APN 5 57,877,473 (GRCm39) missense probably damaging 0.96
IGL00990:Pcdh7 APN 5 57,877,806 (GRCm39) missense possibly damaging 0.94
IGL01367:Pcdh7 APN 5 58,286,566 (GRCm39) missense possibly damaging 0.67
IGL01388:Pcdh7 APN 5 57,877,546 (GRCm39) missense probably damaging 1.00
IGL01543:Pcdh7 APN 5 57,878,107 (GRCm39) missense probably damaging 1.00
IGL01750:Pcdh7 APN 5 57,877,764 (GRCm39) missense probably damaging 1.00
IGL02010:Pcdh7 APN 5 58,286,597 (GRCm39) missense probably benign
IGL02014:Pcdh7 APN 5 57,877,045 (GRCm39) missense probably benign 0.03
IGL02269:Pcdh7 APN 5 58,070,664 (GRCm39) missense probably damaging 1.00
IGL03051:Pcdh7 APN 5 58,286,415 (GRCm39) missense probably damaging 0.99
floated UTSW 5 57,878,704 (GRCm39) missense probably damaging 1.00
proposed UTSW 5 57,879,582 (GRCm39) missense probably damaging 0.99
P0037:Pcdh7 UTSW 5 58,070,590 (GRCm39) missense probably benign 0.17
R0003:Pcdh7 UTSW 5 58,070,590 (GRCm39) missense probably benign 0.17
R0421:Pcdh7 UTSW 5 57,877,402 (GRCm39) missense probably damaging 1.00
R0551:Pcdh7 UTSW 5 57,879,336 (GRCm39) missense probably damaging 0.99
R0562:Pcdh7 UTSW 5 57,877,405 (GRCm39) missense probably damaging 0.99
R0732:Pcdh7 UTSW 5 57,878,657 (GRCm39) missense probably damaging 1.00
R0755:Pcdh7 UTSW 5 57,877,664 (GRCm39) missense possibly damaging 0.86
R1080:Pcdh7 UTSW 5 57,876,768 (GRCm39) missense probably damaging 1.00
R1381:Pcdh7 UTSW 5 57,878,882 (GRCm39) nonsense probably null
R1591:Pcdh7 UTSW 5 57,877,764 (GRCm39) missense probably damaging 1.00
R1891:Pcdh7 UTSW 5 57,878,217 (GRCm39) missense probably damaging 0.98
R2011:Pcdh7 UTSW 5 57,876,971 (GRCm39) missense probably damaging 1.00
R2140:Pcdh7 UTSW 5 58,286,338 (GRCm39) missense probably damaging 1.00
R2147:Pcdh7 UTSW 5 58,286,458 (GRCm39) missense possibly damaging 0.51
R2848:Pcdh7 UTSW 5 57,877,618 (GRCm39) missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57,879,236 (GRCm39) missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57,879,236 (GRCm39) missense probably damaging 1.00
R3719:Pcdh7 UTSW 5 58,286,374 (GRCm39) missense probably damaging 1.00
R4075:Pcdh7 UTSW 5 57,879,150 (GRCm39) missense probably damaging 1.00
R4231:Pcdh7 UTSW 5 57,876,631 (GRCm39) missense possibly damaging 0.94
R4236:Pcdh7 UTSW 5 57,876,631 (GRCm39) missense possibly damaging 0.94
R4352:Pcdh7 UTSW 5 57,879,361 (GRCm39) missense possibly damaging 0.88
R4420:Pcdh7 UTSW 5 58,286,512 (GRCm39) missense probably benign 0.03
R4449:Pcdh7 UTSW 5 57,877,827 (GRCm39) missense probably damaging 1.00
R4584:Pcdh7 UTSW 5 57,878,625 (GRCm39) missense probably damaging 1.00
R4686:Pcdh7 UTSW 5 58,286,511 (GRCm39) missense probably benign
R4837:Pcdh7 UTSW 5 57,877,753 (GRCm39) missense possibly damaging 0.89
R4838:Pcdh7 UTSW 5 57,878,146 (GRCm39) missense probably damaging 1.00
R4947:Pcdh7 UTSW 5 57,879,258 (GRCm39) missense probably damaging 0.98
R5053:Pcdh7 UTSW 5 57,878,943 (GRCm39) missense probably damaging 0.99
R5068:Pcdh7 UTSW 5 57,879,508 (GRCm39) missense probably damaging 1.00
R5117:Pcdh7 UTSW 5 57,879,090 (GRCm39) missense probably benign 0.09
R5132:Pcdh7 UTSW 5 57,885,463 (GRCm39) missense probably benign
R5248:Pcdh7 UTSW 5 58,286,515 (GRCm39) missense probably damaging 0.97
R5294:Pcdh7 UTSW 5 57,885,453 (GRCm39) splice site probably null
R5420:Pcdh7 UTSW 5 57,877,529 (GRCm39) missense probably damaging 1.00
R5777:Pcdh7 UTSW 5 57,876,856 (GRCm39) missense probably damaging 1.00
R5834:Pcdh7 UTSW 5 57,878,970 (GRCm39) missense possibly damaging 0.90
R5870:Pcdh7 UTSW 5 57,877,753 (GRCm39) missense possibly damaging 0.89
R5917:Pcdh7 UTSW 5 57,879,097 (GRCm39) missense probably damaging 0.96
R6014:Pcdh7 UTSW 5 57,878,497 (GRCm39) missense probably damaging 0.99
R6193:Pcdh7 UTSW 5 57,877,666 (GRCm39) missense probably damaging 1.00
R6240:Pcdh7 UTSW 5 57,878,704 (GRCm39) missense probably damaging 1.00
R6335:Pcdh7 UTSW 5 58,099,607 (GRCm39) splice site probably null
R6418:Pcdh7 UTSW 5 57,879,046 (GRCm39) missense probably damaging 1.00
R6907:Pcdh7 UTSW 5 57,876,471 (GRCm39) missense possibly damaging 0.53
R7058:Pcdh7 UTSW 5 57,879,582 (GRCm39) missense probably damaging 0.99
R7069:Pcdh7 UTSW 5 57,877,126 (GRCm39) missense probably benign 0.00
R7073:Pcdh7 UTSW 5 57,878,299 (GRCm39) missense probably benign 0.19
R7463:Pcdh7 UTSW 5 57,878,340 (GRCm39) missense probably benign 0.06
R7509:Pcdh7 UTSW 5 57,877,529 (GRCm39) missense probably damaging 1.00
R7588:Pcdh7 UTSW 5 57,877,246 (GRCm39) missense probably damaging 1.00
R7707:Pcdh7 UTSW 5 57,877,672 (GRCm39) missense probably damaging 0.99
R7734:Pcdh7 UTSW 5 57,876,976 (GRCm39) missense probably damaging 0.99
R7899:Pcdh7 UTSW 5 57,877,152 (GRCm39) missense probably benign
R8194:Pcdh7 UTSW 5 57,877,678 (GRCm39) missense probably damaging 1.00
R8480:Pcdh7 UTSW 5 58,286,407 (GRCm39) missense probably damaging 1.00
R8890:Pcdh7 UTSW 5 57,876,717 (GRCm39) missense probably damaging 1.00
R8906:Pcdh7 UTSW 5 57,879,154 (GRCm39) missense probably damaging 1.00
R8990:Pcdh7 UTSW 5 57,879,364 (GRCm39) missense probably benign 0.06
R9264:Pcdh7 UTSW 5 58,286,663 (GRCm39) missense probably benign 0.09
R9272:Pcdh7 UTSW 5 57,878,779 (GRCm39) missense possibly damaging 0.81
R9294:Pcdh7 UTSW 5 57,878,677 (GRCm39) missense probably benign 0.39
R9518:Pcdh7 UTSW 5 58,070,513 (GRCm39) missense possibly damaging 0.81
R9597:Pcdh7 UTSW 5 57,877,197 (GRCm39) missense possibly damaging 0.68
R9642:Pcdh7 UTSW 5 57,876,717 (GRCm39) missense probably damaging 1.00
R9745:Pcdh7 UTSW 5 57,879,622 (GRCm39) critical splice donor site probably null
X0021:Pcdh7 UTSW 5 57,878,826 (GRCm39) missense possibly damaging 0.95
X0026:Pcdh7 UTSW 5 57,876,721 (GRCm39) missense probably damaging 1.00
Z1177:Pcdh7 UTSW 5 57,877,006 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACCGATCTGTTAATGGTGGG -3'
(R):5'- CCTATAAGGCCTCTGGTACATC -3'

Sequencing Primer
(F):5'- AATGGTGGGCCTGGCAGTC -3'
(R):5'- CTATAAGGCCTCTGGTACATCAGTGG -3'
Posted On 2016-12-15