Incidental Mutation 'R5800:Lrrc8b'
ID447344
Institutional Source Beutler Lab
Gene Symbol Lrrc8b
Ensembl Gene ENSMUSG00000070639
Gene Nameleucine rich repeat containing 8 family, member B
SynonymsR75581
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location105415775-105490074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105481342 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 518 (S518L)
Ref Sequence ENSEMBL: ENSMUSP00000108327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112707]
Predicted Effect probably benign
Transcript: ENSMUST00000112707
AA Change: S518L

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108327
Gene: ENSMUSG00000070639
AA Change: S518L

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 334 2.9e-133 PFAM
LRR 509 536 5.27e1 SMART
LRR 584 607 2.03e1 SMART
LRR 632 654 1.97e1 SMART
LRR_TYP 655 678 4.79e-3 SMART
LRR 679 700 3.09e1 SMART
LRR_TYP 701 724 4.17e-3 SMART
LRR 747 770 2.17e-1 SMART
Meta Mutation Damage Score 0.0912 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Lrrc8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Lrrc8b APN 5 105480499 missense probably damaging 0.96
IGL00519:Lrrc8b APN 5 105481725 missense possibly damaging 0.82
IGL01732:Lrrc8b APN 5 105485960 missense probably damaging 1.00
IGL01799:Lrrc8b APN 5 105485891 missense probably benign
IGL02005:Lrrc8b APN 5 105481054 missense probably benign 0.22
IGL02205:Lrrc8b APN 5 105481837 missense probably benign 0.07
IGL03038:Lrrc8b APN 5 105481492 missense probably damaging 0.98
IGL03076:Lrrc8b APN 5 105481549 missense probably damaging 1.00
IGL02796:Lrrc8b UTSW 5 105481345 missense probably damaging 1.00
R0647:Lrrc8b UTSW 5 105480607 missense possibly damaging 0.69
R0722:Lrrc8b UTSW 5 105480112 missense possibly damaging 0.89
R1382:Lrrc8b UTSW 5 105480883 missense probably damaging 1.00
R1437:Lrrc8b UTSW 5 105481702 missense probably damaging 1.00
R1801:Lrrc8b UTSW 5 105480823 missense probably damaging 1.00
R1888:Lrrc8b UTSW 5 105481351 missense probably benign 0.12
R1888:Lrrc8b UTSW 5 105481351 missense probably benign 0.12
R2169:Lrrc8b UTSW 5 105481887 missense probably damaging 0.99
R4514:Lrrc8b UTSW 5 105479953 missense probably damaging 1.00
R4898:Lrrc8b UTSW 5 105480214 missense probably benign 0.19
R5243:Lrrc8b UTSW 5 105480946 missense probably damaging 1.00
R5264:Lrrc8b UTSW 5 105480252 missense probably damaging 0.98
R5424:Lrrc8b UTSW 5 105480703 missense probably damaging 1.00
R5513:Lrrc8b UTSW 5 105485984 missense probably damaging 1.00
R5632:Lrrc8b UTSW 5 105480297 missense possibly damaging 0.81
R5799:Lrrc8b UTSW 5 105481342 missense probably benign 0.19
R6637:Lrrc8b UTSW 5 105480271 missense possibly damaging 0.80
R7249:Lrrc8b UTSW 5 105481267 missense probably benign 0.23
R7253:Lrrc8b UTSW 5 105481656 missense probably benign 0.01
R7558:Lrrc8b UTSW 5 105481711 missense probably damaging 1.00
R8077:Lrrc8b UTSW 5 105480017 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AGATGGAAGTGCTGAGCCTG -3'
(R):5'- AGTTTGCTTCCCTCATTATCAAGG -3'

Sequencing Primer
(F):5'- TGATCCCGGAAGTCAAGCTG -3'
(R):5'- TATCAAGGGACAGCTTCTGC -3'
Posted On2016-12-15