Incidental Mutation 'R5800:Casp4'
ID447349
Institutional Source Beutler Lab
Gene Symbol Casp4
Ensembl Gene ENSMUSG00000033538
Gene Namecaspase 4, apoptosis-related cysteine peptidase
SynonymsCasp11, Caspase-11, ich-3
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location5308828-5336783 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 5308915 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027012] [ENSMUST00000027015] [ENSMUST00000160064] [ENSMUST00000162846] [ENSMUST00000162846]
Predicted Effect probably null
Transcript: ENSMUST00000027012
SMART Domains Protein: ENSMUSP00000027012
Gene: ENSMUSG00000033538

DomainStartEndE-ValueType
CARD 1 92 7.63e-7 SMART
CASc 121 371 5.72e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000027015
SMART Domains Protein: ENSMUSP00000027015
Gene: ENSMUSG00000025888

DomainStartEndE-ValueType
CARD 4 89 4.91e-19 SMART
CASc 151 400 1.82e-136 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152651
Predicted Effect probably benign
Transcript: ENSMUST00000160064
SMART Domains Protein: ENSMUSP00000124249
Gene: ENSMUSG00000033538

DomainStartEndE-ValueType
CARD 1 89 4.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160521
Predicted Effect probably null
Transcript: ENSMUST00000162846
SMART Domains Protein: ENSMUSP00000124402
Gene: ENSMUSG00000033538

DomainStartEndE-ValueType
Blast:CARD 2 36 2e-17 BLAST
PDB:1IBC|A 18 94 6e-12 PDB
SCOP:g1ibc.1 45 94 6e-15 SMART
Blast:CASc 65 94 7e-13 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000162846
SMART Domains Protein: ENSMUSP00000124402
Gene: ENSMUSG00000033538

DomainStartEndE-ValueType
Blast:CARD 2 36 2e-17 BLAST
PDB:1IBC|A 18 94 6e-12 PDB
SCOP:g1ibc.1 45 94 6e-15 SMART
Blast:CASc 65 94 7e-13 BLAST
Meta Mutation Damage Score 0.9478 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes a member of the cysteine proteases that plays important roles in apoptosis, cell migration and the inflammatory response. The encoded protein mediates production of pro-inflammatory cytokines by macrophages upon bacterial infection. Mice lacking the encoded protein are resistant to endotoxic shock induced by lipopolysaccharide. A 5-bp deletion encompassing a splice acceptor junction resulting in alternate splicing and a shorter non-functional isoform in certain mouse strains has been described. Although its official nomenclature is "caspase 4, apoptosis-related cysteine peptidase", this gene and its encoded protein have historically been called caspase 11. This gene is present in a cluster of three caspase genes on chromosome 9. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in decreased levels of serum IL-1alpha and IL-1beta. Mutant animals are resistant to septic shock after injection with LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Casp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02688:Casp4 APN 9 5322844 missense possibly damaging 0.76
BB007:Casp4 UTSW 9 5321318 missense probably damaging 0.99
BB017:Casp4 UTSW 9 5321318 missense probably damaging 0.99
R1302:Casp4 UTSW 9 5328518 nonsense probably null
R1562:Casp4 UTSW 9 5324733 missense possibly damaging 0.69
R1716:Casp4 UTSW 9 5308919 splice site probably null
R2031:Casp4 UTSW 9 5321401 missense probably benign 0.00
R2655:Casp4 UTSW 9 5322894 missense possibly damaging 0.93
R4207:Casp4 UTSW 9 5328451 missense probably benign 0.15
R4432:Casp4 UTSW 9 5323653 missense probably damaging 1.00
R4911:Casp4 UTSW 9 5328580 unclassified probably benign
R5269:Casp4 UTSW 9 5321521 splice site probably benign
R5399:Casp4 UTSW 9 5324928 nonsense probably null
R5895:Casp4 UTSW 9 5328573 unclassified probably benign
R6582:Casp4 UTSW 9 5324884 missense probably benign 0.01
R7253:Casp4 UTSW 9 5324868 missense probably benign 0.37
R7426:Casp4 UTSW 9 5321345 missense possibly damaging 0.87
R7930:Casp4 UTSW 9 5321318 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGTTTGTTCCCATGACGAAG -3'
(R):5'- ATCTCAGCATGTCCACACTC -3'

Sequencing Primer
(F):5'- AAGGGAGGCCAGTTTTATGAGTTAC -3'
(R):5'- CAGGCTTTTATGCCACTG -3'
Posted On2016-12-15