Mutagenetix > Incidental Mutation

Incidental Mutation 'R5800:Senp6'

447351

Institutional Source

Beutler Lab

Gene Symbol

Senp6

Ensembl Gene

ENSMUSG00000034252

Gene Name

SUMO/sentrin specific peptidase 6

Synonyms

E130319N12Rik, 2810017C20Rik

MMRRC Submission

043389-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5800 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80066903-80144953 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80126433 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 120 (I120F)

Ref Sequence

ENSEMBL: ENSMUSP00000135719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037484] [ENSMUST00000164859] [ENSMUST00000165607] [ENSMUST00000175999] [ENSMUST00000176360] [ENSMUST00000176527]

AlphaFold

Q6P7W0

Predicted Effect

probably damaging
Transcript: ENSMUST00000037484
AA Change: I706F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047220
Gene: ENSMUSG00000034252
AA Change: I706F

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
ZnF_C2HC	242	260	7.23e0	SMART
Pfam:Peptidase_C48	700	826	3.5e-23	PFAM
Pfam:Peptidase_C48	965	1096	1.1e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000164859
AA Change: I540F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128918
Gene: ENSMUSG00000034252
AA Change: I540F

Domain	Start	End	E-Value	Type
ZnF_C2HC	76	94	7.23e0	SMART
Pfam:Peptidase_C48	534	660	5.2e-23	PFAM
Pfam:Peptidase_C48	799	930	1.6e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165458

Predicted Effect

probably damaging
Transcript: ENSMUST00000165607
AA Change: I713F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126777
Gene: ENSMUSG00000034252
AA Change: I713F

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
ZnF_C2HC	249	267	7.23e0	SMART
Pfam:Peptidase_C48	707	833	3.4e-23	PFAM
Pfam:Peptidase_C48	972	1103	1.1e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175910

Predicted Effect

probably benign
Transcript: ENSMUST00000175999

Predicted Effect

probably benign
Transcript: ENSMUST00000176360

Predicted Effect

probably damaging
Transcript: ENSMUST00000176527
AA Change: I120F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135719
Gene: ENSMUSG00000034252
AA Change: I120F

Domain	Start	End	E-Value	Type
Pfam:Peptidase_C48	114	165	6.5e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176607

SMART Domains

Protein: ENSMUSP00000135231
Gene: ENSMUSG00000034252

Domain	Start	End	E-Value	Type
ZnF_C2HC	76	94	7.23e0	SMART
Pfam:Peptidase_C48	534	660	4.9e-23	PFAM
Pfam:Peptidase_C48	799	911	2.1e-14	PFAM

Meta Mutation Damage Score

0.8872

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-like molecules (UBLs), such as SUMO1 (UBL1; MIM 601912), are structurally related to ubiquitin (MIM 191339) and can be ligated to target proteins in a similar manner as ubiquitin. However, covalent attachment of UBLs does not result in degradation of the modified proteins. SUMO1 modification is implicated in the targeting of RANGAP1 (MIM 602362) to the nuclear pore complex, as well as in stabilization of I-kappa-B-alpha (NFKBIA; MIM 164008) from degradation by the 26S proteasome. Like ubiquitin, UBLs are synthesized as precursor proteins, with 1 or more amino acids following the C-terminal glycine-glycine residues of the mature UBL protein. Thus, the tail sequences of the UBL precursors need to be removed by UBL-specific proteases, such as SENP6, prior to their conjugation to target proteins (Kim et al., 2000 [PubMed 10799485]). SENPs also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	G	A	17: 23,717,992	P72S	probably damaging	Het
4932438A13Rik	A	G	3: 37,052,443	D4974G	probably damaging	Het
Abca12	A	T	1: 71,321,432	V540D	possibly damaging	Het
Adamts8	A	T	9: 30,954,482	D442V	probably damaging	Het
Casp4	G	A	9: 5,308,915		probably null	Het
Cfap45	T	A	1: 172,538,600	V30E	probably damaging	Het
Col6a4	A	G	9: 106,080,275	F117L	probably damaging	Het
Dnah7c	A	T	1: 46,647,015	T1810S	probably benign	Het
Drosha	C	T	15: 12,865,067	T627M	probably damaging	Het
Drosha	C	A	15: 12,902,647	A1001D	probably damaging	Het
Efhc1	G	A	1: 20,978,781	V473I	probably benign	Het
Ephx2	T	C	14: 66,107,302	K191R	probably benign	Het
Ero1lb	T	A	13: 12,602,301		probably null	Het
Esyt2	A	T	12: 116,370,188	D837V	possibly damaging	Het
Fip1l1	T	A	5: 74,546,081	D126E	possibly damaging	Het
Fyttd1	C	T	16: 32,891,288	R86C	probably damaging	Het
Gm12888	T	A	4: 121,319,428	T59S	probably damaging	Het
Gm34653	T	C	2: 34,838,642	F151S	possibly damaging	Het
Gm7353	A	T	7: 3,110,168		noncoding transcript	Het
Gpr153	C	T	4: 152,280,077	Q197*	probably null	Het
H2-T23	G	T	17: 36,031,604		probably benign	Het
Ighv1-16	T	A	12: 114,665,911	R85S	probably benign	Het
Ipcef1	T	A	10: 6,890,569	D376V	probably damaging	Het
Kdm1a	T	A	4: 136,573,070		probably null	Het
Klk1b27	A	T	7: 44,055,664	Q85L	probably benign	Het
Krt39	A	T	11: 99,521,145	D38E	probably benign	Het
L1td1	T	C	4: 98,733,762	L187P	possibly damaging	Het
Lrrc8b	C	T	5: 105,481,342	S518L	probably benign	Het
Lyg1	C	T	1: 37,946,953	D176N	probably damaging	Het
Mctp1	A	G	13: 76,688,559	N82D	probably damaging	Het
Muc6	T	C	7: 141,640,423		probably benign	Het
Nynrin	T	C	14: 55,870,631	L1065P	probably damaging	Het
Olfr1474	T	C	19: 13,471,896	S309P	probably benign	Het
Pcdh7	T	A	5: 57,722,225	S1041T	probably damaging	Het
Pkd1l1	T	A	11: 8,861,302	M1518L	probably benign	Het
Prl8a6	G	T	13: 27,435,470	Q90K	probably benign	Het
Ptcd1	T	A	5: 145,159,665	D206V	probably damaging	Het
Rap1gap	C	A	4: 137,720,377	D478E	probably benign	Het
Scn5a	A	G	9: 119,501,666	Y1269H	probably damaging	Het
Sdc2	A	T	15: 33,028,144	H136L	probably benign	Het
Shisa5	G	A	9: 109,056,094		probably null	Het
Slc19a1	A	G	10: 77,042,269	S213G	probably null	Het
Smim8	TTTAATGAAGAGCT	TT	4: 34,771,261		probably benign	Het
Tbc1d20	T	A	2: 152,308,325		probably null	Het
Tll2	T	C	19: 41,104,934	H481R	probably benign	Het
Tmc7	A	G	7: 118,539,440	V692A	probably benign	Het
Tmem234	T	C	4: 129,607,131		probably null	Het
Vmn1r237	C	G	17: 21,314,807	T264S	probably benign	Het
Vmn2r98	A	T	17: 19,065,998	T253S	probably benign	Het
Zfyve27	T	C	19: 42,182,663	Y191H	probably damaging	Het

Other mutations in Senp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Senp6	APN	9	80116610	missense	probably damaging	1.00
IGL00487:Senp6	APN	9	80113838	missense	probably damaging	1.00
IGL01285:Senp6	APN	9	80136718	missense	probably benign	0.05
IGL01337:Senp6	APN	9	80136510	missense	probably damaging	0.97
IGL01563:Senp6	APN	9	80122008	missense	probably benign
IGL01633:Senp6	APN	9	80092394	missense	probably damaging	1.00
IGL02115:Senp6	APN	9	80121926	missense	probably damaging	1.00
IGL02208:Senp6	APN	9	80113943	missense	probably damaging	1.00
IGL02378:Senp6	APN	9	80126392	missense	probably damaging	1.00
A4554:Senp6	UTSW	9	80148458	unclassified	probably benign
R0031:Senp6	UTSW	9	80126243	missense	probably damaging	1.00
R0121:Senp6	UTSW	9	80116670	missense	probably benign	0.01
R0276:Senp6	UTSW	9	80136747	missense	probably benign
R0294:Senp6	UTSW	9	80113725	splice site	probably null
R0308:Senp6	UTSW	9	80132983	critical splice donor site	probably null
R0531:Senp6	UTSW	9	80123884	missense	probably damaging	0.99
R0743:Senp6	UTSW	9	80093589	missense	probably damaging	1.00
R0883:Senp6	UTSW	9	80116559	missense	probably damaging	1.00
R1071:Senp6	UTSW	9	80136729	missense	probably benign	0.35
R1171:Senp6	UTSW	9	80116725	missense	possibly damaging	0.89
R1340:Senp6	UTSW	9	80122023	missense	possibly damaging	0.47
R1571:Senp6	UTSW	9	80093571	missense	probably damaging	1.00
R1760:Senp6	UTSW	9	80118629	missense	probably benign	0.36
R1909:Senp6	UTSW	9	80113774	missense	possibly damaging	0.67
R2008:Senp6	UTSW	9	80126398	missense	probably damaging	1.00
R2067:Senp6	UTSW	9	80089869	missense	probably benign	0.11
R2077:Senp6	UTSW	9	80126155	missense	probably benign	0.14
R2141:Senp6	UTSW	9	80123820	missense	probably damaging	1.00
R2321:Senp6	UTSW	9	80123740	missense	possibly damaging	0.83
R2760:Senp6	UTSW	9	80121978	missense	probably null
R2939:Senp6	UTSW	9	80143842	missense	probably benign	0.00
R2940:Senp6	UTSW	9	80143842	missense	probably benign	0.00
R3081:Senp6	UTSW	9	80143842	missense	probably benign	0.00
R3784:Senp6	UTSW	9	80092286	missense	probably benign	0.16
R3785:Senp6	UTSW	9	80092286	missense	probably benign	0.16
R3800:Senp6	UTSW	9	80087453	missense	possibly damaging	0.89
R3857:Senp6	UTSW	9	80092321	missense	possibly damaging	0.85
R4790:Senp6	UTSW	9	80089858	missense	probably benign	0.20
R5117:Senp6	UTSW	9	80130746	missense	probably damaging	1.00
R5418:Senp6	UTSW	9	80121869	missense	possibly damaging	0.89
R5477:Senp6	UTSW	9	80143843	missense	probably damaging	1.00
R5582:Senp6	UTSW	9	80089876	missense	possibly damaging	0.91
R5717:Senp6	UTSW	9	80092312	missense	probably damaging	0.99
R5802:Senp6	UTSW	9	80118644	unclassified	probably benign
R5899:Senp6	UTSW	9	80142070	splice site	probably benign
R5918:Senp6	UTSW	9	80114116	critical splice donor site	probably null
R5958:Senp6	UTSW	9	80142294	missense	probably damaging	1.00
R6360:Senp6	UTSW	9	80113806	missense	probably benign
R6477:Senp6	UTSW	9	80093625	nonsense	probably null
R6628:Senp6	UTSW	9	80132954	missense	probably damaging	1.00
R6703:Senp6	UTSW	9	80121921	missense	probably damaging	1.00
R7236:Senp6	UTSW	9	80132965	missense	probably damaging	1.00
R7268:Senp6	UTSW	9	80142124	missense	probably damaging	1.00
R7290:Senp6	UTSW	9	80136515	missense	probably benign	0.25
R7319:Senp6	UTSW	9	80126199	missense	probably damaging	1.00
R7422:Senp6	UTSW	9	80113877	missense	probably damaging	1.00
R7474:Senp6	UTSW	9	80142328	missense	probably damaging	1.00
R7480:Senp6	UTSW	9	80121917	missense	probably damaging	1.00
R7491:Senp6	UTSW	9	80123728	nonsense	probably null
R8428:Senp6	UTSW	9	80118512	missense	probably damaging	1.00
R8920:Senp6	UTSW	9	80092279	missense	probably benign	0.06
R9158:Senp6	UTSW	9	80087450	missense	probably benign	0.03
R9300:Senp6	UTSW	9	80142151	missense	probably damaging	1.00
R9347:Senp6	UTSW	9	80139097	missense	possibly damaging	0.89
R9387:Senp6	UTSW	9	80092364	missense	probably damaging	1.00
R9521:Senp6	UTSW	9	80067405	start gained	probably benign
R9652:Senp6	UTSW	9	80113946	missense	probably damaging	1.00
R9794:Senp6	UTSW	9	80092308	missense	probably benign	0.04
Z1176:Senp6	UTSW	9	80142266	missense	probably benign	0.02
Z1177:Senp6	UTSW	9	80103693	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTGGCCCTGTAGAAAAGTGAGC -3'
(R):5'- GTGCTGGCACTTCCTTACTG -3'

Sequencing Primer
(F):5'- CCCTGTAGAAAAGTGAGCAAATGC -3'
(R):5'- CAGGACCTCTGGAAGAGCTTATTC -3'

Posted On

2016-12-15