Incidental Mutation 'R5800:Senp6'
ID 447351
Institutional Source Beutler Lab
Gene Symbol Senp6
Ensembl Gene ENSMUSG00000034252
Gene Name SUMO/sentrin specific peptidase 6
Synonyms 2810017C20Rik, E130319N12Rik
MMRRC Submission 043389-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5800 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 79974185-80052235 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80033715 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 120 (I120F)
Ref Sequence ENSEMBL: ENSMUSP00000135719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037484] [ENSMUST00000164859] [ENSMUST00000165607] [ENSMUST00000175999] [ENSMUST00000176527] [ENSMUST00000176360]
AlphaFold Q6P7W0
Predicted Effect probably damaging
Transcript: ENSMUST00000037484
AA Change: I706F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047220
Gene: ENSMUSG00000034252
AA Change: I706F

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 242 260 7.23e0 SMART
Pfam:Peptidase_C48 700 826 3.5e-23 PFAM
Pfam:Peptidase_C48 965 1096 1.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164859
AA Change: I540F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128918
Gene: ENSMUSG00000034252
AA Change: I540F

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 5.2e-23 PFAM
Pfam:Peptidase_C48 799 930 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165458
Predicted Effect probably damaging
Transcript: ENSMUST00000165607
AA Change: I713F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126777
Gene: ENSMUSG00000034252
AA Change: I713F

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 249 267 7.23e0 SMART
Pfam:Peptidase_C48 707 833 3.4e-23 PFAM
Pfam:Peptidase_C48 972 1103 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175910
Predicted Effect probably benign
Transcript: ENSMUST00000175999
Predicted Effect probably damaging
Transcript: ENSMUST00000176527
AA Change: I120F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135719
Gene: ENSMUSG00000034252
AA Change: I120F

DomainStartEndE-ValueType
Pfam:Peptidase_C48 114 165 6.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176607
SMART Domains Protein: ENSMUSP00000135231
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 4.9e-23 PFAM
Pfam:Peptidase_C48 799 911 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176360
Meta Mutation Damage Score 0.8872 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-like molecules (UBLs), such as SUMO1 (UBL1; MIM 601912), are structurally related to ubiquitin (MIM 191339) and can be ligated to target proteins in a similar manner as ubiquitin. However, covalent attachment of UBLs does not result in degradation of the modified proteins. SUMO1 modification is implicated in the targeting of RANGAP1 (MIM 602362) to the nuclear pore complex, as well as in stabilization of I-kappa-B-alpha (NFKBIA; MIM 164008) from degradation by the 26S proteasome. Like ubiquitin, UBLs are synthesized as precursor proteins, with 1 or more amino acids following the C-terminal glycine-glycine residues of the mature UBL protein. Thus, the tail sequences of the UBL precursors need to be removed by UBL-specific proteases, such as SENP6, prior to their conjugation to target proteins (Kim et al., 2000 [PubMed 10799485]). SENPs also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,360,591 (GRCm39) V540D possibly damaging Het
Adamts8 A T 9: 30,865,778 (GRCm39) D442V probably damaging Het
B3galt9 T C 2: 34,728,654 (GRCm39) F151S possibly damaging Het
Bltp1 A G 3: 37,106,592 (GRCm39) D4974G probably damaging Het
Casp4 G A 9: 5,308,915 (GRCm39) probably null Het
Cfap45 T A 1: 172,366,167 (GRCm39) V30E probably damaging Het
Col6a4 A G 9: 105,957,474 (GRCm39) F117L probably damaging Het
Dnah7c A T 1: 46,686,175 (GRCm39) T1810S probably benign Het
Drosha C T 15: 12,865,153 (GRCm39) T627M probably damaging Het
Drosha C A 15: 12,902,733 (GRCm39) A1001D probably damaging Het
Efhc1 G A 1: 21,049,005 (GRCm39) V473I probably benign Het
Ephx2 T C 14: 66,344,751 (GRCm39) K191R probably benign Het
Ero1b T A 13: 12,617,190 (GRCm39) probably null Het
Esyt2 A T 12: 116,333,808 (GRCm39) D837V possibly damaging Het
Fip1l1 T A 5: 74,706,742 (GRCm39) D126E possibly damaging Het
Fyttd1 C T 16: 32,711,658 (GRCm39) R86C probably damaging Het
Gm12888 T A 4: 121,176,625 (GRCm39) T59S probably damaging Het
Gm7353 A T 7: 3,160,168 (GRCm39) noncoding transcript Het
Gpr153 C T 4: 152,364,534 (GRCm39) Q197* probably null Het
Grep1 G A 17: 23,936,966 (GRCm39) P72S probably damaging Het
H2-T23 G T 17: 36,342,496 (GRCm39) probably benign Het
Ighv1-16 T A 12: 114,629,531 (GRCm39) R85S probably benign Het
Ipcef1 T A 10: 6,840,569 (GRCm39) D376V probably damaging Het
Kdm1a T A 4: 136,300,381 (GRCm39) probably null Het
Klk1b27 A T 7: 43,705,088 (GRCm39) Q85L probably benign Het
Krt39 A T 11: 99,411,971 (GRCm39) D38E probably benign Het
L1td1 T C 4: 98,621,999 (GRCm39) L187P possibly damaging Het
Lrrc8b C T 5: 105,629,208 (GRCm39) S518L probably benign Het
Lyg1 C T 1: 37,986,034 (GRCm39) D176N probably damaging Het
Mctp1 A G 13: 76,836,678 (GRCm39) N82D probably damaging Het
Muc6 T C 7: 141,226,690 (GRCm39) probably benign Het
Nynrin T C 14: 56,108,088 (GRCm39) L1065P probably damaging Het
Or5b118 T C 19: 13,449,260 (GRCm39) S309P probably benign Het
Pcdh7 T A 5: 57,879,567 (GRCm39) S1041T probably damaging Het
Pkd1l1 T A 11: 8,811,302 (GRCm39) M1518L probably benign Het
Prl8a6 G T 13: 27,619,453 (GRCm39) Q90K probably benign Het
Ptcd1 T A 5: 145,096,475 (GRCm39) D206V probably damaging Het
Rap1gap C A 4: 137,447,688 (GRCm39) D478E probably benign Het
Scn5a A G 9: 119,330,732 (GRCm39) Y1269H probably damaging Het
Sdc2 A T 15: 33,028,290 (GRCm39) H136L probably benign Het
Shisa5 G A 9: 108,885,162 (GRCm39) probably null Het
Slc19a1 A G 10: 76,878,103 (GRCm39) S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 (GRCm39) probably benign Het
Tbc1d20 T A 2: 152,150,245 (GRCm39) probably null Het
Tll2 T C 19: 41,093,373 (GRCm39) H481R probably benign Het
Tmc7 A G 7: 118,138,663 (GRCm39) V692A probably benign Het
Tmem234 T C 4: 129,500,924 (GRCm39) probably null Het
Vmn1r237 C G 17: 21,535,069 (GRCm39) T264S probably benign Het
Vmn2r98 A T 17: 19,286,260 (GRCm39) T253S probably benign Het
Zfyve27 T C 19: 42,171,102 (GRCm39) Y191H probably damaging Het
Other mutations in Senp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Senp6 APN 9 80,023,892 (GRCm39) missense probably damaging 1.00
IGL00487:Senp6 APN 9 80,021,120 (GRCm39) missense probably damaging 1.00
IGL01285:Senp6 APN 9 80,044,000 (GRCm39) missense probably benign 0.05
IGL01337:Senp6 APN 9 80,043,792 (GRCm39) missense probably damaging 0.97
IGL01563:Senp6 APN 9 80,029,290 (GRCm39) missense probably benign
IGL01633:Senp6 APN 9 79,999,676 (GRCm39) missense probably damaging 1.00
IGL02115:Senp6 APN 9 80,029,208 (GRCm39) missense probably damaging 1.00
IGL02208:Senp6 APN 9 80,021,225 (GRCm39) missense probably damaging 1.00
IGL02378:Senp6 APN 9 80,033,674 (GRCm39) missense probably damaging 1.00
A4554:Senp6 UTSW 9 80,055,740 (GRCm39) unclassified probably benign
R0031:Senp6 UTSW 9 80,033,525 (GRCm39) missense probably damaging 1.00
R0121:Senp6 UTSW 9 80,023,952 (GRCm39) missense probably benign 0.01
R0276:Senp6 UTSW 9 80,044,029 (GRCm39) missense probably benign
R0294:Senp6 UTSW 9 80,021,007 (GRCm39) splice site probably null
R0308:Senp6 UTSW 9 80,040,265 (GRCm39) critical splice donor site probably null
R0531:Senp6 UTSW 9 80,031,166 (GRCm39) missense probably damaging 0.99
R0743:Senp6 UTSW 9 80,000,871 (GRCm39) missense probably damaging 1.00
R0883:Senp6 UTSW 9 80,023,841 (GRCm39) missense probably damaging 1.00
R1071:Senp6 UTSW 9 80,044,011 (GRCm39) missense probably benign 0.35
R1171:Senp6 UTSW 9 80,024,007 (GRCm39) missense possibly damaging 0.89
R1340:Senp6 UTSW 9 80,029,305 (GRCm39) missense possibly damaging 0.47
R1571:Senp6 UTSW 9 80,000,853 (GRCm39) missense probably damaging 1.00
R1760:Senp6 UTSW 9 80,025,911 (GRCm39) missense probably benign 0.36
R1909:Senp6 UTSW 9 80,021,056 (GRCm39) missense possibly damaging 0.67
R2008:Senp6 UTSW 9 80,033,680 (GRCm39) missense probably damaging 1.00
R2067:Senp6 UTSW 9 79,997,151 (GRCm39) missense probably benign 0.11
R2077:Senp6 UTSW 9 80,033,437 (GRCm39) missense probably benign 0.14
R2141:Senp6 UTSW 9 80,031,102 (GRCm39) missense probably damaging 1.00
R2321:Senp6 UTSW 9 80,031,022 (GRCm39) missense possibly damaging 0.83
R2760:Senp6 UTSW 9 80,029,260 (GRCm39) missense probably null
R2939:Senp6 UTSW 9 80,051,124 (GRCm39) missense probably benign 0.00
R2940:Senp6 UTSW 9 80,051,124 (GRCm39) missense probably benign 0.00
R3081:Senp6 UTSW 9 80,051,124 (GRCm39) missense probably benign 0.00
R3784:Senp6 UTSW 9 79,999,568 (GRCm39) missense probably benign 0.16
R3785:Senp6 UTSW 9 79,999,568 (GRCm39) missense probably benign 0.16
R3800:Senp6 UTSW 9 79,994,735 (GRCm39) missense possibly damaging 0.89
R3857:Senp6 UTSW 9 79,999,603 (GRCm39) missense possibly damaging 0.85
R4790:Senp6 UTSW 9 79,997,140 (GRCm39) missense probably benign 0.20
R5117:Senp6 UTSW 9 80,038,028 (GRCm39) missense probably damaging 1.00
R5418:Senp6 UTSW 9 80,029,151 (GRCm39) missense possibly damaging 0.89
R5477:Senp6 UTSW 9 80,051,125 (GRCm39) missense probably damaging 1.00
R5582:Senp6 UTSW 9 79,997,158 (GRCm39) missense possibly damaging 0.91
R5717:Senp6 UTSW 9 79,999,594 (GRCm39) missense probably damaging 0.99
R5802:Senp6 UTSW 9 80,025,926 (GRCm39) unclassified probably benign
R5899:Senp6 UTSW 9 80,049,352 (GRCm39) splice site probably benign
R5918:Senp6 UTSW 9 80,021,398 (GRCm39) critical splice donor site probably null
R5958:Senp6 UTSW 9 80,049,576 (GRCm39) missense probably damaging 1.00
R6360:Senp6 UTSW 9 80,021,088 (GRCm39) missense probably benign
R6477:Senp6 UTSW 9 80,000,907 (GRCm39) nonsense probably null
R6628:Senp6 UTSW 9 80,040,236 (GRCm39) missense probably damaging 1.00
R6703:Senp6 UTSW 9 80,029,203 (GRCm39) missense probably damaging 1.00
R7236:Senp6 UTSW 9 80,040,247 (GRCm39) missense probably damaging 1.00
R7268:Senp6 UTSW 9 80,049,406 (GRCm39) missense probably damaging 1.00
R7290:Senp6 UTSW 9 80,043,797 (GRCm39) missense probably benign 0.25
R7319:Senp6 UTSW 9 80,033,481 (GRCm39) missense probably damaging 1.00
R7422:Senp6 UTSW 9 80,021,159 (GRCm39) missense probably damaging 1.00
R7474:Senp6 UTSW 9 80,049,610 (GRCm39) missense probably damaging 1.00
R7480:Senp6 UTSW 9 80,029,199 (GRCm39) missense probably damaging 1.00
R7491:Senp6 UTSW 9 80,031,010 (GRCm39) nonsense probably null
R8428:Senp6 UTSW 9 80,025,794 (GRCm39) missense probably damaging 1.00
R8920:Senp6 UTSW 9 79,999,561 (GRCm39) missense probably benign 0.06
R9158:Senp6 UTSW 9 79,994,732 (GRCm39) missense probably benign 0.03
R9300:Senp6 UTSW 9 80,049,433 (GRCm39) missense probably damaging 1.00
R9347:Senp6 UTSW 9 80,046,379 (GRCm39) missense possibly damaging 0.89
R9387:Senp6 UTSW 9 79,999,646 (GRCm39) missense probably damaging 1.00
R9521:Senp6 UTSW 9 79,974,687 (GRCm39) start gained probably benign
R9652:Senp6 UTSW 9 80,021,228 (GRCm39) missense probably damaging 1.00
R9794:Senp6 UTSW 9 79,999,590 (GRCm39) missense probably benign 0.04
Z1176:Senp6 UTSW 9 80,049,548 (GRCm39) missense probably benign 0.02
Z1177:Senp6 UTSW 9 80,010,975 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGCCCTGTAGAAAAGTGAGC -3'
(R):5'- GTGCTGGCACTTCCTTACTG -3'

Sequencing Primer
(F):5'- CCCTGTAGAAAAGTGAGCAAATGC -3'
(R):5'- CAGGACCTCTGGAAGAGCTTATTC -3'
Posted On 2016-12-15