Incidental Mutation 'R5800:Senp6'
ID447351
Institutional Source Beutler Lab
Gene Symbol Senp6
Ensembl Gene ENSMUSG00000034252
Gene NameSUMO/sentrin specific peptidase 6
SynonymsE130319N12Rik, 2810017C20Rik
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location80066903-80144953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80126433 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 120 (I120F)
Ref Sequence ENSEMBL: ENSMUSP00000135719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037484] [ENSMUST00000164859] [ENSMUST00000165607] [ENSMUST00000175999] [ENSMUST00000176360] [ENSMUST00000176527]
Predicted Effect probably damaging
Transcript: ENSMUST00000037484
AA Change: I706F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047220
Gene: ENSMUSG00000034252
AA Change: I706F

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 242 260 7.23e0 SMART
Pfam:Peptidase_C48 700 826 3.5e-23 PFAM
Pfam:Peptidase_C48 965 1096 1.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164859
AA Change: I540F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128918
Gene: ENSMUSG00000034252
AA Change: I540F

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 5.2e-23 PFAM
Pfam:Peptidase_C48 799 930 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165458
Predicted Effect probably damaging
Transcript: ENSMUST00000165607
AA Change: I713F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126777
Gene: ENSMUSG00000034252
AA Change: I713F

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 249 267 7.23e0 SMART
Pfam:Peptidase_C48 707 833 3.4e-23 PFAM
Pfam:Peptidase_C48 972 1103 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175910
Predicted Effect probably benign
Transcript: ENSMUST00000175999
Predicted Effect probably benign
Transcript: ENSMUST00000176360
Predicted Effect probably damaging
Transcript: ENSMUST00000176527
AA Change: I120F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135719
Gene: ENSMUSG00000034252
AA Change: I120F

DomainStartEndE-ValueType
Pfam:Peptidase_C48 114 165 6.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176607
SMART Domains Protein: ENSMUSP00000135231
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 4.9e-23 PFAM
Pfam:Peptidase_C48 799 911 2.1e-14 PFAM
Meta Mutation Damage Score 0.8872 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-like molecules (UBLs), such as SUMO1 (UBL1; MIM 601912), are structurally related to ubiquitin (MIM 191339) and can be ligated to target proteins in a similar manner as ubiquitin. However, covalent attachment of UBLs does not result in degradation of the modified proteins. SUMO1 modification is implicated in the targeting of RANGAP1 (MIM 602362) to the nuclear pore complex, as well as in stabilization of I-kappa-B-alpha (NFKBIA; MIM 164008) from degradation by the 26S proteasome. Like ubiquitin, UBLs are synthesized as precursor proteins, with 1 or more amino acids following the C-terminal glycine-glycine residues of the mature UBL protein. Thus, the tail sequences of the UBL precursors need to be removed by UBL-specific proteases, such as SENP6, prior to their conjugation to target proteins (Kim et al., 2000 [PubMed 10799485]). SENPs also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Senp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Senp6 APN 9 80116610 missense probably damaging 1.00
IGL00487:Senp6 APN 9 80113838 missense probably damaging 1.00
IGL01285:Senp6 APN 9 80136718 missense probably benign 0.05
IGL01337:Senp6 APN 9 80136510 missense probably damaging 0.97
IGL01563:Senp6 APN 9 80122008 missense probably benign
IGL01633:Senp6 APN 9 80092394 missense probably damaging 1.00
IGL02115:Senp6 APN 9 80121926 missense probably damaging 1.00
IGL02208:Senp6 APN 9 80113943 missense probably damaging 1.00
IGL02378:Senp6 APN 9 80126392 missense probably damaging 1.00
A4554:Senp6 UTSW 9 80148458 unclassified probably benign
R0031:Senp6 UTSW 9 80126243 missense probably damaging 1.00
R0121:Senp6 UTSW 9 80116670 missense probably benign 0.01
R0276:Senp6 UTSW 9 80136747 missense probably benign
R0294:Senp6 UTSW 9 80113725 splice site probably null
R0308:Senp6 UTSW 9 80132983 critical splice donor site probably null
R0531:Senp6 UTSW 9 80123884 missense probably damaging 0.99
R0743:Senp6 UTSW 9 80093589 missense probably damaging 1.00
R0883:Senp6 UTSW 9 80116559 missense probably damaging 1.00
R1071:Senp6 UTSW 9 80136729 missense probably benign 0.35
R1171:Senp6 UTSW 9 80116725 missense possibly damaging 0.89
R1340:Senp6 UTSW 9 80122023 missense possibly damaging 0.47
R1571:Senp6 UTSW 9 80093571 missense probably damaging 1.00
R1760:Senp6 UTSW 9 80118629 missense probably benign 0.36
R1909:Senp6 UTSW 9 80113774 missense possibly damaging 0.67
R2008:Senp6 UTSW 9 80126398 missense probably damaging 1.00
R2067:Senp6 UTSW 9 80089869 missense probably benign 0.11
R2077:Senp6 UTSW 9 80126155 missense probably benign 0.14
R2141:Senp6 UTSW 9 80123820 missense probably damaging 1.00
R2321:Senp6 UTSW 9 80123740 missense possibly damaging 0.83
R2760:Senp6 UTSW 9 80121978 missense probably null
R2939:Senp6 UTSW 9 80143842 missense probably benign 0.00
R2940:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3081:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3784:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3785:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3800:Senp6 UTSW 9 80087453 missense possibly damaging 0.89
R3857:Senp6 UTSW 9 80092321 missense possibly damaging 0.85
R4790:Senp6 UTSW 9 80089858 missense probably benign 0.20
R5117:Senp6 UTSW 9 80130746 missense probably damaging 1.00
R5418:Senp6 UTSW 9 80121869 missense possibly damaging 0.89
R5477:Senp6 UTSW 9 80143843 missense probably damaging 1.00
R5582:Senp6 UTSW 9 80089876 missense possibly damaging 0.91
R5717:Senp6 UTSW 9 80092312 missense probably damaging 0.99
R5802:Senp6 UTSW 9 80118644 unclassified probably benign
R5899:Senp6 UTSW 9 80142070 splice site probably benign
R5918:Senp6 UTSW 9 80114116 critical splice donor site probably null
R5958:Senp6 UTSW 9 80142294 missense probably damaging 1.00
R6360:Senp6 UTSW 9 80113806 missense probably benign
R6477:Senp6 UTSW 9 80093625 nonsense probably null
R6628:Senp6 UTSW 9 80132954 missense probably damaging 1.00
R6703:Senp6 UTSW 9 80121921 missense probably damaging 1.00
R7236:Senp6 UTSW 9 80132965 missense probably damaging 1.00
R7268:Senp6 UTSW 9 80142124 missense probably damaging 1.00
R7290:Senp6 UTSW 9 80136515 missense probably benign 0.25
R7319:Senp6 UTSW 9 80126199 missense probably damaging 1.00
R7422:Senp6 UTSW 9 80113877 missense probably damaging 1.00
R7474:Senp6 UTSW 9 80142328 missense probably damaging 1.00
R7480:Senp6 UTSW 9 80121917 missense probably damaging 1.00
R7491:Senp6 UTSW 9 80123728 nonsense probably null
R8428:Senp6 UTSW 9 80118512 missense probably damaging 1.00
Z1176:Senp6 UTSW 9 80142266 missense probably benign 0.02
Z1177:Senp6 UTSW 9 80103693 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGCCCTGTAGAAAAGTGAGC -3'
(R):5'- GTGCTGGCACTTCCTTACTG -3'

Sequencing Primer
(F):5'- CCCTGTAGAAAAGTGAGCAAATGC -3'
(R):5'- CAGGACCTCTGGAAGAGCTTATTC -3'
Posted On2016-12-15