Incidental Mutation 'R5800:Shisa5'
ID447353
Institutional Source Beutler Lab
Gene Symbol Shisa5
Ensembl Gene ENSMUSG00000025647
Gene Nameshisa family member 5
Synonyms2310008D10Rik, Scotin, 6430628I05Rik
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109038565-109057777 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 109056094 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026737] [ENSMUST00000045011] [ENSMUST00000061973] [ENSMUST00000112053] [ENSMUST00000112059] [ENSMUST00000128062] [ENSMUST00000154184] [ENSMUST00000159614] [ENSMUST00000160217] [ENSMUST00000161521] [ENSMUST00000196954] [ENSMUST00000196954] [ENSMUST00000197099] [ENSMUST00000197099] [ENSMUST00000197483] [ENSMUST00000197483] [ENSMUST00000197689] [ENSMUST00000197689] [ENSMUST00000198295] [ENSMUST00000198295] [ENSMUST00000198376] [ENSMUST00000198708] [ENSMUST00000198708] [ENSMUST00000200515] [ENSMUST00000200629] [ENSMUST00000198281]
Predicted Effect probably null
Transcript: ENSMUST00000026737
SMART Domains Protein: ENSMUSP00000026737
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Shisa 24 211 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045011
SMART Domains Protein: ENSMUSP00000044831
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 8e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061973
SMART Domains Protein: ENSMUSP00000050971
Gene: ENSMUSG00000049734

DomainStartEndE-ValueType
EXOIII 13 217 2.45e-13 SMART
low complexity region 248 283 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112053
SMART Domains Protein: ENSMUSP00000107684
Gene: ENSMUSG00000049734

DomainStartEndE-ValueType
EXOIII 13 217 2.45e-13 SMART
low complexity region 248 283 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112059
SMART Domains Protein: ENSMUSP00000107690
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Shisa 26 198 1.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128062
SMART Domains Protein: ENSMUSP00000118499
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
PDB:3MXJ|A 1 150 4e-97 PDB
SCOP:d1fxxa_ 12 146 7e-12 SMART
Blast:EXOIII 13 150 1e-85 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000154184
SMART Domains Protein: ENSMUSP00000128901
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 108 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159614
SMART Domains Protein: ENSMUSP00000124854
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 54 60 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160217
SMART Domains Protein: ENSMUSP00000125264
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 3e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 533 550 N/A INTRINSIC
low complexity region 570 581 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160928
SMART Domains Protein: ENSMUSP00000123837
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 19 116 9e-3 SMART
low complexity region 249 261 N/A INTRINSIC
low complexity region 465 471 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 521 532 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161163
Predicted Effect probably benign
Transcript: ENSMUST00000161521
SMART Domains Protein: ENSMUSP00000125615
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
coiled coil region 108 208 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198639
Predicted Effect probably null
Transcript: ENSMUST00000196954
SMART Domains Protein: ENSMUSP00000143599
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196954
SMART Domains Protein: ENSMUSP00000143599
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197099
SMART Domains Protein: ENSMUSP00000143648
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 129 9.9e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197099
SMART Domains Protein: ENSMUSP00000143648
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 129 9.9e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197483
SMART Domains Protein: ENSMUSP00000143613
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197483
SMART Domains Protein: ENSMUSP00000143613
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197689
SMART Domains Protein: ENSMUSP00000142874
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 63 4.3e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197689
SMART Domains Protein: ENSMUSP00000142874
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 63 4.3e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198295
SMART Domains Protein: ENSMUSP00000143721
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 70 1.3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198295
SMART Domains Protein: ENSMUSP00000143721
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 70 1.3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198376
SMART Domains Protein: ENSMUSP00000143374
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 83 5e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198708
SMART Domains Protein: ENSMUSP00000142978
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 109 7.8e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198708
SMART Domains Protein: ENSMUSP00000142978
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 109 7.8e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199868
Predicted Effect probably null
Transcript: ENSMUST00000200515
SMART Domains Protein: ENSMUSP00000142835
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 11 147 4.1e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200629
SMART Domains Protein: ENSMUSP00000142404
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 72 1.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197194
Predicted Effect probably benign
Transcript: ENSMUST00000198281
SMART Domains Protein: ENSMUSP00000143581
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 16 74 2.1e-13 PFAM
Meta Mutation Damage Score 0.9581 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the shisa family. The encoded protein is localized to the endoplasmic reticulum, and together with p53 induces apoptosis in a caspase-dependent manner. Alternative splicing results in multiple transcript variants. Related pseudogenes of this gene are found on chromosome X. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and exhibit no apparent phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Shisa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02735:Shisa5 APN 9 109056012 missense probably damaging 1.00
IGL02989:Shisa5 APN 9 109055994 missense probably damaging 1.00
IGL03169:Shisa5 APN 9 109056492 missense probably damaging 1.00
R1809:Shisa5 UTSW 9 109040930 missense probably damaging 0.99
R1813:Shisa5 UTSW 9 109056040 missense probably damaging 0.99
R1896:Shisa5 UTSW 9 109056040 missense probably damaging 0.99
R2516:Shisa5 UTSW 9 109056507 critical splice donor site probably null
R4706:Shisa5 UTSW 9 109056060 missense probably null 0.99
R5935:Shisa5 UTSW 9 109056683 missense possibly damaging 0.68
R7299:Shisa5 UTSW 9 109054884 intron probably benign
R7301:Shisa5 UTSW 9 109054884 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCTTTTGCCAAAAGGGGTCCC -3'
(R):5'- GACAGCTGCAACGAGAATCC -3'

Sequencing Primer
(F):5'- AAAGGTGGTTACACTGGC -3'
(R):5'- CAGCTGCAACGAGAATCCTGATTAG -3'
Posted On2016-12-15