Incidental Mutation 'R5800:Ipcef1'
ID447355
Institutional Source Beutler Lab
Gene Symbol Ipcef1
Ensembl Gene ENSMUSG00000064065
Gene Nameinteraction protein for cytohesin exchange factors 1
Synonyms
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location6885796-7052478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6890569 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 376 (D376V)
Ref Sequence ENSEMBL: ENSMUSP00000101242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052751] [ENSMUST00000063036] [ENSMUST00000078070] [ENSMUST00000105601] [ENSMUST00000105611] [ENSMUST00000105615] [ENSMUST00000105617] [ENSMUST00000123861] [ENSMUST00000129221] [ENSMUST00000129954] [ENSMUST00000135502] [ENSMUST00000144264] [ENSMUST00000147171] [ENSMUST00000154941]
Predicted Effect probably benign
Transcript: ENSMUST00000052751
SMART Domains Protein: ENSMUSP00000060329
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063036
SMART Domains Protein: ENSMUSP00000053498
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 8.7e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078070
AA Change: D380V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077215
Gene: ENSMUSG00000064065
AA Change: D380V

DomainStartEndE-ValueType
PH 14 114 5.87e-20 SMART
low complexity region 132 150 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
Blast:PH 286 343 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105601
SMART Domains Protein: ENSMUSP00000101226
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105611
SMART Domains Protein: ENSMUSP00000101236
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.4e-10 PFAM
Pfam:7tm_1 85 336 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105615
SMART Domains Protein: ENSMUSP00000101240
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 1.3e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105617
AA Change: D376V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101242
Gene: ENSMUSG00000064065
AA Change: D376V

DomainStartEndE-ValueType
PH 14 114 5.87e-20 SMART
low complexity region 132 153 N/A INTRINSIC
low complexity region 242 257 N/A INTRINSIC
Blast:PH 282 339 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123861
SMART Domains Protein: ENSMUSP00000120187
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129221
SMART Domains Protein: ENSMUSP00000123117
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 15 287 7.3e-11 PFAM
Pfam:7tm_1 21 272 2.4e-67 PFAM
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129954
SMART Domains Protein: ENSMUSP00000122385
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 6.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.5e-10 PFAM
Pfam:7tm_1 85 336 5.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135502
SMART Domains Protein: ENSMUSP00000135143
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.9e-10 PFAM
Pfam:7tm_1 85 336 7.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141897
Predicted Effect probably benign
Transcript: ENSMUST00000144264
SMART Domains Protein: ENSMUSP00000115836
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147171
SMART Domains Protein: ENSMUSP00000117950
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 9.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154941
SMART Domains Protein: ENSMUSP00000115413
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 9.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 15 287 6.1e-11 PFAM
Pfam:7tm_1 21 272 2e-67 PFAM
Meta Mutation Damage Score 0.2501 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Ipcef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Ipcef1 APN 10 6919968 missense probably damaging 1.00
IGL01018:Ipcef1 APN 10 6890551 missense probably benign
IGL01295:Ipcef1 APN 10 6900642 missense probably damaging 1.00
IGL01738:Ipcef1 APN 10 6890575 missense probably damaging 1.00
IGL03095:Ipcef1 APN 10 6919732 missense probably damaging 1.00
R0001:Ipcef1 UTSW 10 6900600 missense probably damaging 0.99
R0206:Ipcef1 UTSW 10 6920062 missense probably damaging 1.00
R0208:Ipcef1 UTSW 10 6920062 missense probably damaging 1.00
R1161:Ipcef1 UTSW 10 6980288 critical splice acceptor site probably null
R1496:Ipcef1 UTSW 10 6935173 critical splice donor site probably null
R1592:Ipcef1 UTSW 10 6935182 splice site probably null
R1829:Ipcef1 UTSW 10 6919900 missense probably benign 0.27
R1893:Ipcef1 UTSW 10 6900680 missense probably damaging 1.00
R2107:Ipcef1 UTSW 10 6890501 missense probably benign 0.01
R2160:Ipcef1 UTSW 10 6890650 missense probably damaging 1.00
R2413:Ipcef1 UTSW 10 6935225 missense probably damaging 1.00
R2655:Ipcef1 UTSW 10 6979657 missense probably benign 0.02
R2886:Ipcef1 UTSW 10 6900641 missense probably damaging 1.00
R4752:Ipcef1 UTSW 10 6979573 missense probably damaging 1.00
R5134:Ipcef1 UTSW 10 6919950 missense probably benign 0.03
R5938:Ipcef1 UTSW 10 6908029 unclassified probably benign
R5989:Ipcef1 UTSW 10 6979532 nonsense probably null
R7397:Ipcef1 UTSW 10 6972244 makesense probably null
R7414:Ipcef1 UTSW 10 6890673 nonsense probably null
R7425:Ipcef1 UTSW 10 6956066 missense probably damaging 1.00
R7859:Ipcef1 UTSW 10 6890569 missense probably damaging 1.00
R7966:Ipcef1 UTSW 10 6900668 missense probably damaging 1.00
R8255:Ipcef1 UTSW 10 6920007 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCAGAATGAATGCCCTTGG -3'
(R):5'- ATTGGTAGTGTTGCAGCCC -3'

Sequencing Primer
(F):5'- CCTTGGCAGCATCCTGTAGAATG -3'
(R):5'- TCCCCATGTCTGTGAAAGGG -3'
Posted On2016-12-15