Incidental Mutation 'R5800:Slc19a1'
ID447356
Institutional Source Beutler Lab
Gene Symbol Slc19a1
Ensembl Gene ENSMUSG00000001436
Gene Namesolute carrier family 19 (folate transporter), member 1
SynonymsRFC1, RFC-1, reduced folate carrier
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location77032241-77061002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77042269 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 213 (S213G)
Ref Sequence ENSEMBL: ENSMUSP00000121237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105410] [ENSMUST00000130703] [ENSMUST00000132984] [ENSMUST00000133059] [ENSMUST00000136150] [ENSMUST00000136925] [ENSMUST00000144234]
Predicted Effect probably benign
Transcript: ENSMUST00000105410
AA Change: S213G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000101050
Gene: ENSMUSG00000001436
AA Change: S213G

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 427 3e-167 PFAM
Pfam:MFS_1 66 406 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127249
Predicted Effect probably benign
Transcript: ENSMUST00000130703
SMART Domains Protein: ENSMUSP00000115658
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 64 9.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131031
SMART Domains Protein: ENSMUSP00000114884
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 1 112 1.3e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132984
AA Change: S213G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000116657
Gene: ENSMUSG00000001436
AA Change: S213G

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 233 4.8e-88 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133059
SMART Domains Protein: ENSMUSP00000120266
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 70 7.3e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136150
AA Change: S213G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121237
Gene: ENSMUSG00000001436
AA Change: S213G

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 242 1.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136925
AA Change: S213G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000119382
Gene: ENSMUSG00000001436
AA Change: S213G

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 426 7.8e-163 PFAM
Pfam:MFS_1 66 405 4.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144234
AA Change: S213G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116784
Gene: ENSMUSG00000001436
AA Change: S213G

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 427 3e-167 PFAM
Pfam:MFS_1 66 406 2.6e-13 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a transporter of folate and is involved in the regulation of intracellular concentrations of folate. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null embryos die due to abnormalities of hematopoietic organs. Mutant mice may be partially rescued with maternal folic acid supplementation, but these mice still present with hematopoietic organ defects and show impaired development of urogenital structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Slc19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0112:Slc19a1 UTSW 10 77042165 missense probably benign 0.04
R0211:Slc19a1 UTSW 10 77038466 missense possibly damaging 0.92
R0419:Slc19a1 UTSW 10 77042908 missense probably damaging 1.00
R1459:Slc19a1 UTSW 10 77042535 nonsense probably null
R1725:Slc19a1 UTSW 10 77041838 missense probably benign 0.03
R2202:Slc19a1 UTSW 10 77041924 missense possibly damaging 0.71
R2203:Slc19a1 UTSW 10 77041924 missense possibly damaging 0.71
R2221:Slc19a1 UTSW 10 77042486 missense probably benign 0.00
R3861:Slc19a1 UTSW 10 77041975 missense possibly damaging 0.88
R3968:Slc19a1 UTSW 10 77041846 missense probably damaging 1.00
R6106:Slc19a1 UTSW 10 77044769 missense probably damaging 1.00
R6501:Slc19a1 UTSW 10 77049606 missense probably benign 0.11
R6992:Slc19a1 UTSW 10 77049706 missense possibly damaging 0.86
R7909:Slc19a1 UTSW 10 77049540 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTACTGCTGGGAGTCTTC -3'
(R):5'- TTCTCCACAGGACATGCAC -3'

Sequencing Primer
(F):5'- ACTGCTGGGAGTCTTCATCAGC -3'
(R):5'- TTCTCCACAGGACATGCACATAGTAG -3'
Posted On2016-12-15