Incidental Mutation 'R5800:Krt39'
ID447359
Institutional Source Beutler Lab
Gene Symbol Krt39
Ensembl Gene ENSMUSG00000064165
Gene Namekeratin 39
Synonyms4732494G06Rik
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99514114-99521338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99521145 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 38 (D38E)
Ref Sequence ENSEMBL: ENSMUSP00000103069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076948] [ENSMUST00000107445]
Predicted Effect probably benign
Transcript: ENSMUST00000076948
AA Change: D38E

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000076216
Gene: ENSMUSG00000064165
AA Change: D38E

DomainStartEndE-ValueType
Pfam:Filament 90 401 7.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107445
AA Change: D38E

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103069
Gene: ENSMUSG00000064165
AA Change: D38E

DomainStartEndE-ValueType
Filament 90 401 2.63e-130 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Krt39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Krt39 APN 11 99519063 missense probably damaging 0.97
IGL02179:Krt39 APN 11 99520841 missense probably damaging 1.00
IGL02478:Krt39 APN 11 99520897 missense probably benign 0.37
IGL02578:Krt39 APN 11 99521206 missense probably benign 0.00
IGL03090:Krt39 APN 11 99519007 splice site probably benign
IGL03094:Krt39 APN 11 99520802 splice site probably benign
R0532:Krt39 UTSW 11 99514791 missense possibly damaging 0.92
R0789:Krt39 UTSW 11 99521062 missense probably benign 0.00
R1856:Krt39 UTSW 11 99519088 nonsense probably null
R1920:Krt39 UTSW 11 99514635 missense probably benign 0.00
R1944:Krt39 UTSW 11 99519823 missense probably damaging 1.00
R4391:Krt39 UTSW 11 99514752 missense probably benign 0.01
R4678:Krt39 UTSW 11 99521000 missense probably benign 0.02
R4921:Krt39 UTSW 11 99514749 missense possibly damaging 0.80
R6207:Krt39 UTSW 11 99521215 missense probably damaging 1.00
R6904:Krt39 UTSW 11 99519821 missense probably damaging 1.00
R7034:Krt39 UTSW 11 99521236 missense probably benign 0.19
R7036:Krt39 UTSW 11 99521236 missense probably benign 0.19
R7131:Krt39 UTSW 11 99520871 missense probably benign
R7424:Krt39 UTSW 11 99518091 missense probably damaging 1.00
R7449:Krt39 UTSW 11 99518061 missense probably benign 0.02
R7627:Krt39 UTSW 11 99514749 missense possibly damaging 0.80
R7774:Krt39 UTSW 11 99514611 splice site probably null
R7784:Krt39 UTSW 11 99521031 nonsense probably null
R7827:Krt39 UTSW 11 99519075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTTCAAAATCTGCATGGTCTC -3'
(R):5'- TGTCACCACCTGGAAGGAAG -3'

Sequencing Primer
(F):5'- GCATGGTCTCCTTCTCATGAGTG -3'
(R):5'- CCACAGGCTGGCATTTGG -3'
Posted On2016-12-15