Incidental Mutation 'R5800:Mctp1'
ID447364
Institutional Source Beutler Lab
Gene Symbol Mctp1
Ensembl Gene ENSMUSG00000021596
Gene Namemultiple C2 domains, transmembrane 1
Synonyms
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location76384535-77031810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76688559 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 82 (N82D)
Ref Sequence ENSEMBL: ENSMUSP00000105218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109583] [ENSMUST00000109589] [ENSMUST00000125209] [ENSMUST00000126960]
Predicted Effect probably benign
Transcript: ENSMUST00000109583
AA Change: N45D

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105212
Gene: ENSMUSG00000021596
AA Change: N45D

DomainStartEndE-ValueType
C2 3 100 1.15e-15 SMART
C2 166 263 1.35e-21 SMART
C2 322 418 4.76e-22 SMART
transmembrane domain 513 535 N/A INTRINSIC
Pfam:PRT_C 542 672 3.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109589
AA Change: N82D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105218
Gene: ENSMUSG00000021596
AA Change: N82D

DomainStartEndE-ValueType
C2 40 137 1.15e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125209
AA Change: N302D

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118958
Gene: ENSMUSG00000021596
AA Change: N302D

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 134 174 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
C2 260 357 1.15e-15 SMART
C2 423 520 1.35e-21 SMART
C2 579 675 4.76e-22 SMART
transmembrane domain 770 792 N/A INTRINSIC
Pfam:PRT_C 800 929 2.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126960
AA Change: N82D

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120673
Gene: ENSMUSG00000021596
AA Change: N82D

DomainStartEndE-ValueType
C2 40 137 1.15e-15 SMART
C2 190 286 8.43e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178439
Meta Mutation Damage Score 0.3239 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Mctp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mctp1 APN 13 77020798 missense probably damaging 0.98
IGL01355:Mctp1 APN 13 76384955 missense probably benign
IGL02192:Mctp1 APN 13 76731768 intron probably benign
IGL02342:Mctp1 APN 13 77024857 missense probably damaging 1.00
IGL02706:Mctp1 APN 13 76823069 missense probably damaging 1.00
IGL02950:Mctp1 APN 13 77024810 missense probably damaging 1.00
IGL03064:Mctp1 APN 13 76801513 nonsense probably null
IGL03230:Mctp1 APN 13 76824857 missense possibly damaging 0.49
R0138:Mctp1 UTSW 13 76827712 missense probably damaging 1.00
R0355:Mctp1 UTSW 13 76824863 missense probably damaging 1.00
R0383:Mctp1 UTSW 13 76801544 missense probably damaging 1.00
R0426:Mctp1 UTSW 13 77020821 missense probably benign 0.01
R0462:Mctp1 UTSW 13 76801401 missense probably damaging 1.00
R0483:Mctp1 UTSW 13 76827727 missense probably damaging 1.00
R0685:Mctp1 UTSW 13 76825799 critical splice donor site probably null
R1468:Mctp1 UTSW 13 76825273 missense probably benign 0.25
R1468:Mctp1 UTSW 13 76825273 missense probably benign 0.25
R1854:Mctp1 UTSW 13 76825741 missense probably damaging 0.96
R1864:Mctp1 UTSW 13 76385148 missense possibly damaging 0.63
R1865:Mctp1 UTSW 13 76385148 missense possibly damaging 0.63
R1920:Mctp1 UTSW 13 76384610 missense possibly damaging 0.67
R2071:Mctp1 UTSW 13 76759724 missense probably damaging 1.00
R2127:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R2128:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R2129:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R3709:Mctp1 UTSW 13 76824880 splice site probably null
R4463:Mctp1 UTSW 13 76712087 missense probably damaging 1.00
R4510:Mctp1 UTSW 13 76825272 missense probably benign 0.20
R4511:Mctp1 UTSW 13 76825272 missense probably benign 0.20
R4951:Mctp1 UTSW 13 76827775 missense probably damaging 0.96
R5004:Mctp1 UTSW 13 76641804 missense possibly damaging 0.79
R5307:Mctp1 UTSW 13 76712079 critical splice acceptor site probably null
R5339:Mctp1 UTSW 13 76825706 intron probably benign
R5639:Mctp1 UTSW 13 77024783 splice site silent
R5769:Mctp1 UTSW 13 76759808 missense probably damaging 1.00
R5913:Mctp1 UTSW 13 76759825 splice site probably null
R5981:Mctp1 UTSW 13 76757110 missense probably damaging 1.00
R6024:Mctp1 UTSW 13 76385161 missense probably damaging 0.98
R6192:Mctp1 UTSW 13 76822963 splice site probably null
R6331:Mctp1 UTSW 13 77020863 critical splice donor site probably null
R6468:Mctp1 UTSW 13 76731811 critical splice donor site probably null
R6484:Mctp1 UTSW 13 76688625 missense probably benign 0.02
R6656:Mctp1 UTSW 13 77029936 missense probably damaging 0.99
R7026:Mctp1 UTSW 13 76806259 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GCAAGTTTGAAGGATTGTGCTC -3'
(R):5'- AGTCACTGGGGAAGAGTCTC -3'

Sequencing Primer
(F):5'- CAGTACTTGAGAAAATTTCCTCCC -3'
(R):5'- TCTCTTCAGACACGTGAGAAAC -3'
Posted On2016-12-15