Mutagenetix > Incidental Mutations

Incidental Mutation 'R5800:Drosha'

447367

Institutional Source

Beutler Lab

Gene Symbol

Drosha

Ensembl Gene

ENSMUSG00000022191

Gene Name

drosha, ribonuclease type III

Synonyms

1110013A17Rik, Rnasen, Etohi2

MMRRC Submission

043389-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R5800 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12824815-12935291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 12865067 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 627 (T627M)

Ref Sequence

ENSEMBL: ENSMUSP00000129279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]

Predicted Effect

probably damaging
Transcript: ENSMUST00000090292
AA Change: T627M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191
AA Change: T627M

Domain	Start	End	E-Value	Type
low complexity region	13	32	N/A	INTRINSIC
low complexity region	43	69	N/A	INTRINSIC
low complexity region	72	102	N/A	INTRINSIC
low complexity region	109	137	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	185	200	N/A	INTRINSIC
low complexity region	227	269	N/A	INTRINSIC
low complexity region	273	301	N/A	INTRINSIC
low complexity region	357	370	N/A	INTRINSIC
low complexity region	387	410	N/A	INTRINSIC
low complexity region	472	499	N/A	INTRINSIC
SCOP:d1jfza_	878	902	4e-4	SMART
RIBOc	942	1076	1.73e-45	SMART
Blast:RIBOc	1086	1112	1e-6	BLAST
RIBOc	1121	1253	1.6e-49	SMART
DSRM	1260	1332	5.75e-20	SMART
coiled coil region	1346	1370	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121499
Gene: ENSMUSG00000022191
AA Change: T269M

Domain	Start	End	E-Value	Type
low complexity region	115	142	N/A	INTRINSIC
SCOP:d1jfza_	521	545	6e-4	SMART
RIBOc	585	719	1.73e-45	SMART
Blast:RIBOc	729	755	1e-6	BLAST
RIBOc	764	896	1.6e-49	SMART
DSRM	903	975	5.75e-20	SMART
coiled coil region	988	1012	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150211

Predicted Effect

probably damaging
Transcript: ENSMUST00000169061
AA Change: T627M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191
AA Change: T627M

Domain	Start	End	E-Value	Type
low complexity region	13	32	N/A	INTRINSIC
low complexity region	43	69	N/A	INTRINSIC
low complexity region	72	102	N/A	INTRINSIC
low complexity region	109	137	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	185	200	N/A	INTRINSIC
low complexity region	227	269	N/A	INTRINSIC
low complexity region	273	301	N/A	INTRINSIC
low complexity region	357	370	N/A	INTRINSIC
low complexity region	387	410	N/A	INTRINSIC
low complexity region	472	499	N/A	INTRINSIC
SCOP:d1jfza_	878	902	4e-4	SMART
RIBOc	942	1076	1.73e-45	SMART
Blast:RIBOc	1086	1112	1e-6	BLAST
RIBOc	1121	1253	1.6e-49	SMART
DSRM	1260	1332	5.75e-20	SMART
coiled coil region	1346	1370	N/A	INTRINSIC

Meta Mutation Damage Score

0.1984

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	G	A	17: 23,717,992	P72S	probably damaging	Het
4932438A13Rik	A	G	3: 37,052,443	D4974G	probably damaging	Het
Abca12	A	T	1: 71,321,432	V540D	possibly damaging	Het
Adamts8	A	T	9: 30,954,482	D442V	probably damaging	Het
Casp4	G	A	9: 5,308,915		probably null	Het
Cfap45	T	A	1: 172,538,600	V30E	probably damaging	Het
Col6a4	A	G	9: 106,080,275	F117L	probably damaging	Het
Dnah7c	A	T	1: 46,647,015	T1810S	probably benign	Het
Efhc1	G	A	1: 20,978,781	V473I	probably benign	Het
Ephx2	T	C	14: 66,107,302	K191R	probably benign	Het
Ero1lb	T	A	13: 12,602,301		probably null	Het
Esyt2	A	T	12: 116,370,188	D837V	possibly damaging	Het
Fip1l1	T	A	5: 74,546,081	D126E	possibly damaging	Het
Fyttd1	C	T	16: 32,891,288	R86C	probably damaging	Het
Gm12888	T	A	4: 121,319,428	T59S	probably damaging	Het
Gm34653	T	C	2: 34,838,642	F151S	possibly damaging	Het
Gm7353	A	T	7: 3,110,168		noncoding transcript	Het
Gpr153	C	T	4: 152,280,077	Q197*	probably null	Het
H2-T23	G	T	17: 36,031,604		probably benign	Het
Ighv1-16	T	A	12: 114,665,911	R85S	probably benign	Het
Ipcef1	T	A	10: 6,890,569	D376V	probably damaging	Het
Kdm1a	T	A	4: 136,573,070		probably null	Het
Klk1b27	A	T	7: 44,055,664	Q85L	probably benign	Het
Krt39	A	T	11: 99,521,145	D38E	probably benign	Het
L1td1	T	C	4: 98,733,762	L187P	possibly damaging	Het
Lrrc8b	C	T	5: 105,481,342	S518L	probably benign	Het
Lyg1	C	T	1: 37,946,953	D176N	probably damaging	Het
Mctp1	A	G	13: 76,688,559	N82D	probably damaging	Het
Muc6	T	C	7: 141,640,423		probably benign	Het
Nynrin	T	C	14: 55,870,631	L1065P	probably damaging	Het
Olfr1474	T	C	19: 13,471,896	S309P	probably benign	Het
Pcdh7	T	A	5: 57,722,225	S1041T	probably damaging	Het
Pkd1l1	T	A	11: 8,861,302	M1518L	probably benign	Het
Prl8a6	G	T	13: 27,435,470	Q90K	probably benign	Het
Ptcd1	T	A	5: 145,159,665	D206V	probably damaging	Het
Rap1gap	C	A	4: 137,720,377	D478E	probably benign	Het
Scn5a	A	G	9: 119,501,666	Y1269H	probably damaging	Het
Sdc2	A	T	15: 33,028,144	H136L	probably benign	Het
Senp6	A	T	9: 80,126,433	I120F	probably damaging	Het
Shisa5	G	A	9: 109,056,094		probably null	Het
Slc19a1	A	G	10: 77,042,269	S213G	probably null	Het
Smim8	TTTAATGAAGAGCT	TT	4: 34,771,261		probably benign	Het
Tbc1d20	T	A	2: 152,308,325		probably null	Het
Tll2	T	C	19: 41,104,934	H481R	probably benign	Het
Tmc7	A	G	7: 118,539,440	V692A	probably benign	Het
Tmem234	T	C	4: 129,607,131		probably null	Het
Vmn1r237	C	G	17: 21,314,807	T264S	probably benign	Het
Vmn2r98	A	T	17: 19,065,998	T253S	probably benign	Het
Zfyve27	T	C	19: 42,182,663	Y191H	probably damaging	Het

Other mutations in Drosha

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00576:Drosha	APN	15	12883194	missense	probably damaging	0.99
IGL00736:Drosha	APN	15	12833959	missense	unknown
IGL00963:Drosha	APN	15	12925997	missense	probably damaging	0.99
IGL01010:Drosha	APN	15	12827289	unclassified	probably benign
IGL01340:Drosha	APN	15	12834023	intron	probably benign
IGL01481:Drosha	APN	15	12842439	missense	probably benign
IGL01714:Drosha	APN	15	12878784	missense	probably damaging	1.00
IGL01721:Drosha	APN	15	12846112	nonsense	probably null
IGL01765:Drosha	APN	15	12902680	missense	probably damaging	1.00
IGL01893:Drosha	APN	15	12866650	splice site	probably benign
IGL01944:Drosha	APN	15	12889719	missense	probably damaging	1.00
IGL02285:Drosha	APN	15	12833864	missense	unknown
IGL02970:Drosha	APN	15	12913956	missense	probably damaging	0.98
IGL02990:Drosha	APN	15	12827267	unclassified	probably benign
IGL03019:Drosha	APN	15	12846099	missense	probably damaging	1.00
IGL03279:Drosha	APN	15	12859392	missense	probably benign	0.03
IGL03390:Drosha	APN	15	12884983	splice site	probably null
tippicanoe	UTSW	15	12859465	splice site	probably null
Tyler	UTSW	15	12861706	missense	probably benign	0.45
R0115:Drosha	UTSW	15	12846130	missense	probably benign	0.15
R0352:Drosha	UTSW	15	12837288	missense	unknown
R0401:Drosha	UTSW	15	12926031	nonsense	probably null
R0541:Drosha	UTSW	15	12907388	missense	probably benign	0.09
R0784:Drosha	UTSW	15	12867678	splice site	probably benign
R0918:Drosha	UTSW	15	12842533	critical splice donor site	probably null
R1473:Drosha	UTSW	15	12912520	missense	probably benign	0.04
R1503:Drosha	UTSW	15	12848073	missense	probably benign	0.02
R1526:Drosha	UTSW	15	12913984	missense	probably damaging	1.00
R1809:Drosha	UTSW	15	12890112	missense	probably null	1.00
R1859:Drosha	UTSW	15	12878718	missense	probably benign	0.14
R2004:Drosha	UTSW	15	12915381	missense	probably damaging	0.98
R2060:Drosha	UTSW	15	12924159	missense	possibly damaging	0.94
R2516:Drosha	UTSW	15	12859465	splice site	probably null
R3691:Drosha	UTSW	15	12834638	missense	unknown
R3784:Drosha	UTSW	15	12890529	missense	possibly damaging	0.82
R3789:Drosha	UTSW	15	12912537	nonsense	probably null
R3790:Drosha	UTSW	15	12912537	nonsense	probably null
R4020:Drosha	UTSW	15	12837336	missense	possibly damaging	0.96
R4817:Drosha	UTSW	15	12914047	missense	probably damaging	0.97
R4989:Drosha	UTSW	15	12935007	missense	probably benign	0.05
R5080:Drosha	UTSW	15	12842143	missense	probably benign	0.01
R5132:Drosha	UTSW	15	12837291	missense	unknown
R5215:Drosha	UTSW	15	12885133	intron	probably benign
R5386:Drosha	UTSW	15	12842121	missense	probably benign
R5457:Drosha	UTSW	15	12926029	missense	probably benign	0.26
R5536:Drosha	UTSW	15	12929711	missense	possibly damaging	0.58
R5800:Drosha	UTSW	15	12902647	missense	probably damaging	1.00
R5915:Drosha	UTSW	15	12935066	missense	probably damaging	0.97
R5988:Drosha	UTSW	15	12834496	intron	probably benign
R6033:Drosha	UTSW	15	12925999	missense	probably benign	0.25
R6033:Drosha	UTSW	15	12925999	missense	probably benign	0.25
R6063:Drosha	UTSW	15	12834070	intron	probably benign
R6391:Drosha	UTSW	15	12889717	nonsense	probably null
R6492:Drosha	UTSW	15	12861706	missense	probably benign	0.45
R6799:Drosha	UTSW	15	12912537	nonsense	probably null
R6870:Drosha	UTSW	15	12907393	missense	probably benign	0.17
R6920:Drosha	UTSW	15	12834310	missense	unknown
R7101:Drosha	UTSW	15	12865067	missense	probably damaging	1.00
R7142:Drosha	UTSW	15	12924146	missense	possibly damaging	0.70
R7275:Drosha	UTSW	15	12846083	missense	possibly damaging	0.73
R7337:Drosha	UTSW	15	12846199	missense	possibly damaging	0.80
R7471:Drosha	UTSW	15	12889656	missense	probably damaging	1.00
R7538:Drosha	UTSW	15	12926243	missense	probably damaging	1.00
R7559:Drosha	UTSW	15	12842422	missense	probably damaging	0.96
R7651:Drosha	UTSW	15	12859436	missense	probably benign	0.30
R7652:Drosha	UTSW	15	12859436	missense	probably benign	0.30
R7653:Drosha	UTSW	15	12859436	missense	probably benign	0.30
R7727:Drosha	UTSW	15	12881645	missense	probably damaging	1.00
R7780:Drosha	UTSW	15	12848086	missense	probably benign	0.01
R8068:Drosha	UTSW	15	12883190	nonsense	probably null
R8283:Drosha	UTSW	15	12890501	missense	possibly damaging	0.47
R8523:Drosha	UTSW	15	12834322	missense	unknown
R8985:Drosha	UTSW	15	12924101	missense	possibly damaging	0.66
Z1177:Drosha	UTSW	15	12842092	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGAGTAAACGTTTTGCCCAGG -3'
(R):5'- GGCACCAGAGCTACATCATAGTG -3'

Sequencing Primer
(F):5'- GTTTTGCCCAGGCTGCTC -3'
(R):5'- ATCATAGTGACCCTTCTGACAGG -3'

Posted On

2016-12-15