Incidental Mutation 'R5800:Olfr1474'
ID447375
Institutional Source Beutler Lab
Gene Symbol Olfr1474
Ensembl Gene ENSMUSG00000096273
Gene Nameolfactory receptor 1474
SynonymsMOR202-42, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527
MMRRC Submission 043389-MU
Accession Numbers

Genbank: NM_001011842.1

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13469565-13472157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13471896 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 309 (S309P)
Ref Sequence ENSEMBL: ENSMUSP00000151810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]
Predicted Effect probably benign
Transcript: ENSMUST00000096202
AA Change: S309P

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: S309P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1e-7 PFAM
Pfam:7tm_1 39 288 8.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207529
Predicted Effect probably benign
Transcript: ENSMUST00000220113
AA Change: S309P

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

none

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Olfr1474
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Olfr1474 APN 19 13471267 missense probably damaging 0.99
D605:Olfr1474 UTSW 19 13471157 nonsense probably null
R0173:Olfr1474 UTSW 19 13471701 missense probably benign 0.02
R1102:Olfr1474 UTSW 19 13471407 missense probably damaging 0.97
R1515:Olfr1474 UTSW 19 13471680 missense probably damaging 0.97
R1780:Olfr1474 UTSW 19 13471362 missense probably benign 0.14
R2061:Olfr1474 UTSW 19 13471241 missense probably damaging 0.98
R4016:Olfr1474 UTSW 19 13471197 missense possibly damaging 0.95
R4485:Olfr1474 UTSW 19 13471555 missense probably benign 0.08
R5119:Olfr1474 UTSW 19 13471546 missense probably benign 0.00
R5150:Olfr1474 UTSW 19 13471430 missense probably benign 0.01
R5156:Olfr1474 UTSW 19 13471673 missense probably damaging 1.00
R5699:Olfr1474 UTSW 19 13470972 start codon destroyed probably null 0.78
R5840:Olfr1474 UTSW 19 13471878 missense probably benign 0.01
R5953:Olfr1474 UTSW 19 13471368 missense possibly damaging 0.92
R5997:Olfr1474 UTSW 19 13471506 missense probably benign 0.12
R6233:Olfr1474 UTSW 19 13471740 missense probably damaging 1.00
R6488:Olfr1474 UTSW 19 13471617 missense probably damaging 1.00
R6847:Olfr1474 UTSW 19 13471038 missense probably benign 0.03
R6964:Olfr1474 UTSW 19 13471361 nonsense probably null
R7214:Olfr1474 UTSW 19 13470973 start codon destroyed probably null 1.00
R8001:Olfr1474 UTSW 19 13471422 missense probably benign 0.03
R8035:Olfr1474 UTSW 19 13471899 missense probably benign
R8129:Olfr1474 UTSW 19 13471144 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGGCCTTCTCTACCTGTG -3'
(R):5'- TGCTTGGGAATTTTGAGCTCTATAATC -3'

Sequencing Primer
(F):5'- GTGCATCTCATCTCATCACTGTG -3'
(R):5'- CATGGCAAAATATACACCAATTTCAC -3'
Posted On2016-12-15