Incidental Mutation 'R5800:Tll2'
ID447376
Institutional Source Beutler Lab
Gene Symbol Tll2
Ensembl Gene ENSMUSG00000025013
Gene Nametolloid-like 2
Synonyms
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location41083981-41206774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41104934 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 481 (H481R)
Ref Sequence ENSEMBL: ENSMUSP00000125973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025986] [ENSMUST00000169941]
Predicted Effect probably benign
Transcript: ENSMUST00000025986
AA Change: H498R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025986
Gene: ENSMUSG00000025013
AA Change: H498R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
ZnMc 152 294 1.15e-54 SMART
CUB 348 460 7.69e-44 SMART
CUB 461 573 8.69e-52 SMART
EGF_CA 573 614 1.26e-11 SMART
CUB 617 729 3.99e-51 SMART
EGF_CA 729 769 5.92e-8 SMART
CUB 773 885 3.08e-43 SMART
CUB 886 1002 2.25e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169941
AA Change: H481R

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125973
Gene: ENSMUSG00000025013
AA Change: H481R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
ZnMc 152 294 1.15e-54 SMART
CUB 331 443 7.69e-44 SMART
CUB 444 556 8.69e-52 SMART
EGF_CA 556 597 1.26e-11 SMART
CUB 600 712 3.99e-51 SMART
EGF_CA 712 752 5.92e-8 SMART
CUB 756 868 3.08e-43 SMART
CUB 869 985 2.25e-36 SMART
Meta Mutation Damage Score 0.1293 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased muscle weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Zfyve27 T C 19: 42,182,663 Y191H probably damaging Het
Other mutations in Tll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Tll2 APN 19 41086366 missense probably benign 0.01
IGL02028:Tll2 APN 19 41098649 nonsense probably null
IGL02146:Tll2 APN 19 41097837 missense probably benign 0.00
IGL02192:Tll2 APN 19 41086263 missense possibly damaging 0.73
IGL02544:Tll2 APN 19 41135965 missense probably damaging 1.00
PIT4677001:Tll2 UTSW 19 41130558 missense probably benign 0.14
R0141:Tll2 UTSW 19 41097912 missense probably damaging 1.00
R0372:Tll2 UTSW 19 41183313 critical splice acceptor site probably null
R0393:Tll2 UTSW 19 41088826 missense possibly damaging 0.95
R0402:Tll2 UTSW 19 41098693 missense possibly damaging 0.56
R0613:Tll2 UTSW 19 41104990 missense probably damaging 0.97
R0756:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R0757:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R0790:Tll2 UTSW 19 41103850 missense probably damaging 0.98
R0834:Tll2 UTSW 19 41113073 missense probably damaging 1.00
R0843:Tll2 UTSW 19 41128463 splice site probably null
R1014:Tll2 UTSW 19 41103851 missense probably damaging 1.00
R1178:Tll2 UTSW 19 41092847 missense probably damaging 1.00
R1233:Tll2 UTSW 19 41095984 missense possibly damaging 0.79
R1364:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1367:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1368:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1519:Tll2 UTSW 19 41086400 missense probably benign 0.17
R1894:Tll2 UTSW 19 41088671 critical splice donor site probably null
R1896:Tll2 UTSW 19 41113059 missense probably benign 0.44
R1917:Tll2 UTSW 19 41128497 missense possibly damaging 0.83
R2170:Tll2 UTSW 19 41183275 missense probably damaging 1.00
R4433:Tll2 UTSW 19 41121348 missense probably benign 0.03
R4617:Tll2 UTSW 19 41098636 missense probably benign 0.31
R4831:Tll2 UTSW 19 41130512 missense probably damaging 1.00
R5057:Tll2 UTSW 19 41117266 missense probably benign 0.02
R5119:Tll2 UTSW 19 41130509 missense possibly damaging 0.48
R5194:Tll2 UTSW 19 41095897 missense probably damaging 1.00
R5280:Tll2 UTSW 19 41117257 missense possibly damaging 0.87
R5602:Tll2 UTSW 19 41104981 missense possibly damaging 0.63
R6223:Tll2 UTSW 19 41135952 missense possibly damaging 0.54
R7047:Tll2 UTSW 19 41086240 missense probably damaging 0.99
R7155:Tll2 UTSW 19 41117284 missense possibly damaging 0.72
R7213:Tll2 UTSW 19 41120227 missense probably damaging 0.97
R7231:Tll2 UTSW 19 41086234 missense probably benign 0.02
R7390:Tll2 UTSW 19 41120169 critical splice donor site probably null
R7414:Tll2 UTSW 19 41103829 missense probably damaging 0.98
R7757:Tll2 UTSW 19 41096008 missense probably damaging 1.00
R8165:Tll2 UTSW 19 41088874 missense possibly damaging 0.79
R8418:Tll2 UTSW 19 41092837 missense probably damaging 1.00
X0027:Tll2 UTSW 19 41183303 missense probably damaging 1.00
Z1177:Tll2 UTSW 19 41092734 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CTTGTGCCAGCAAGACAAG -3'
(R):5'- GCCATTCACCTGTGTTTGGAAG -3'

Sequencing Primer
(F):5'- ACTGAGCCATCTTCCCCAGG -3'
(R):5'- ACCTGTGTTTGGAAGACCCTTTC -3'
Posted On2016-12-15