Incidental Mutation 'R5800:Zfyve27'
ID447377
Institutional Source Beutler Lab
Gene Symbol Zfyve27
Ensembl Gene ENSMUSG00000018820
Gene Namezinc finger, FYVE domain containing 27
Synonymsprotrudin, 2210011N02Rik, 9530077C24Rik
MMRRC Submission 043389-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5800 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location42163951-42194590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42182663 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 191 (Y191H)
Ref Sequence ENSEMBL: ENSMUSP00000130684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099443] [ENSMUST00000168130] [ENSMUST00000169536]
Predicted Effect probably damaging
Transcript: ENSMUST00000099443
AA Change: Y191H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097042
Gene: ENSMUSG00000018820
AA Change: Y191H

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
transmembrane domain 190 212 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
FYVE 335 408 2.52e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165783
Predicted Effect probably damaging
Transcript: ENSMUST00000168130
AA Change: Y97H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129561
Gene: ENSMUSG00000018820
AA Change: Y97H

DomainStartEndE-ValueType
transmembrane domain 96 118 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169536
AA Change: Y191H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130684
Gene: ENSMUSG00000018820
AA Change: Y191H

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
transmembrane domain 190 212 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
FYVE 342 415 2.52e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170184
Meta Mutation Damage Score 0.4128 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with several transmembrane domains, a Rab11-binding domain and a lipid-binding FYVE finger domain. The encoded protein appears to promote neurite formation. A mutation in this gene has been reported to be associated with hereditary spastic paraplegia, however the pathogenicity of the mutation, which may simply represent a polymorphism, is unclear. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik G A 17: 23,717,992 P72S probably damaging Het
4932438A13Rik A G 3: 37,052,443 D4974G probably damaging Het
Abca12 A T 1: 71,321,432 V540D possibly damaging Het
Adamts8 A T 9: 30,954,482 D442V probably damaging Het
Casp4 G A 9: 5,308,915 probably null Het
Cfap45 T A 1: 172,538,600 V30E probably damaging Het
Col6a4 A G 9: 106,080,275 F117L probably damaging Het
Dnah7c A T 1: 46,647,015 T1810S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Drosha C A 15: 12,902,647 A1001D probably damaging Het
Efhc1 G A 1: 20,978,781 V473I probably benign Het
Ephx2 T C 14: 66,107,302 K191R probably benign Het
Ero1lb T A 13: 12,602,301 probably null Het
Esyt2 A T 12: 116,370,188 D837V possibly damaging Het
Fip1l1 T A 5: 74,546,081 D126E possibly damaging Het
Fyttd1 C T 16: 32,891,288 R86C probably damaging Het
Gm12888 T A 4: 121,319,428 T59S probably damaging Het
Gm34653 T C 2: 34,838,642 F151S possibly damaging Het
Gm7353 A T 7: 3,110,168 noncoding transcript Het
Gpr153 C T 4: 152,280,077 Q197* probably null Het
H2-T23 G T 17: 36,031,604 probably benign Het
Ighv1-16 T A 12: 114,665,911 R85S probably benign Het
Ipcef1 T A 10: 6,890,569 D376V probably damaging Het
Kdm1a T A 4: 136,573,070 probably null Het
Klk1b27 A T 7: 44,055,664 Q85L probably benign Het
Krt39 A T 11: 99,521,145 D38E probably benign Het
L1td1 T C 4: 98,733,762 L187P possibly damaging Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Lyg1 C T 1: 37,946,953 D176N probably damaging Het
Mctp1 A G 13: 76,688,559 N82D probably damaging Het
Muc6 T C 7: 141,640,423 probably benign Het
Nynrin T C 14: 55,870,631 L1065P probably damaging Het
Olfr1474 T C 19: 13,471,896 S309P probably benign Het
Pcdh7 T A 5: 57,722,225 S1041T probably damaging Het
Pkd1l1 T A 11: 8,861,302 M1518L probably benign Het
Prl8a6 G T 13: 27,435,470 Q90K probably benign Het
Ptcd1 T A 5: 145,159,665 D206V probably damaging Het
Rap1gap C A 4: 137,720,377 D478E probably benign Het
Scn5a A G 9: 119,501,666 Y1269H probably damaging Het
Sdc2 A T 15: 33,028,144 H136L probably benign Het
Senp6 A T 9: 80,126,433 I120F probably damaging Het
Shisa5 G A 9: 109,056,094 probably null Het
Slc19a1 A G 10: 77,042,269 S213G probably null Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tbc1d20 T A 2: 152,308,325 probably null Het
Tll2 T C 19: 41,104,934 H481R probably benign Het
Tmc7 A G 7: 118,539,440 V692A probably benign Het
Tmem234 T C 4: 129,607,131 probably null Het
Vmn1r237 C G 17: 21,314,807 T264S probably benign Het
Vmn2r98 A T 17: 19,065,998 T253S probably benign Het
Other mutations in Zfyve27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Zfyve27 APN 19 42183433 missense probably benign
IGL02040:Zfyve27 APN 19 42179391 missense probably damaging 1.00
IGL02048:Zfyve27 APN 19 42185857 missense probably damaging 0.99
IGL02135:Zfyve27 APN 19 42184136 missense probably damaging 1.00
Forgotten UTSW 19 42189577 missense probably damaging 1.00
ignored UTSW 19 42171731 missense probably benign 0.01
overlooked UTSW 19 42182657 critical splice acceptor site probably null
R0388:Zfyve27 UTSW 19 42189585 missense probably damaging 1.00
R1589:Zfyve27 UTSW 19 42171745 critical splice donor site probably null
R1908:Zfyve27 UTSW 19 42171548 start codon destroyed probably null 1.00
R2151:Zfyve27 UTSW 19 42171731 missense probably benign 0.01
R2204:Zfyve27 UTSW 19 42183446 missense probably damaging 1.00
R2205:Zfyve27 UTSW 19 42183446 missense probably damaging 1.00
R5819:Zfyve27 UTSW 19 42183496 missense probably benign 0.00
R5870:Zfyve27 UTSW 19 42171671 missense probably benign 0.01
R5959:Zfyve27 UTSW 19 42179448 missense unknown
R6217:Zfyve27 UTSW 19 42189577 missense probably damaging 1.00
R6281:Zfyve27 UTSW 19 42182755 missense probably damaging 1.00
R6337:Zfyve27 UTSW 19 42182657 critical splice acceptor site probably null
R6638:Zfyve27 UTSW 19 42181497 splice site probably null
R7438:Zfyve27 UTSW 19 42189520 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCCAGCGATGTGGTACTTC -3'
(R):5'- AAACAGGTCCTCTGAGTGGG -3'

Sequencing Primer
(F):5'- ACAGATGTTCCACACTGGTTTG -3'
(R):5'- TCTGAGTGGGCCAGGAC -3'
Posted On2016-12-15