Incidental Mutation 'R5799:AA986860'
ID447379
Institutional Source Beutler Lab
Gene Symbol AA986860
Ensembl Gene ENSMUSG00000042510
Gene Nameexpressed sequence AA986860
Synonyms
MMRRC Submission 043388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5799 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130731976-130744622 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 130741171 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 92 (Q92*)
Ref Sequence ENSEMBL: ENSMUSP00000046172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039323]
Predicted Effect probably null
Transcript: ENSMUST00000039323
AA Change: Q92*
SMART Domains Protein: ENSMUSP00000046172
Gene: ENSMUSG00000042510
AA Change: Q92*

DomainStartEndE-ValueType
Pfam:SARG 33 606 1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190859
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 89% (51/57)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,769 E284G probably damaging Het
Accsl T C 2: 93,864,403 probably null Het
Ahnak2 T C 12: 112,778,930 probably benign Het
Alcam T C 16: 52,309,849 D46G probably benign Het
Asap2 T C 12: 21,168,246 S57P probably damaging Het
Atg14 A T 14: 47,547,295 V314D possibly damaging Het
C230029F24Rik C T 1: 49,338,148 noncoding transcript Het
Calcr A T 6: 3,707,592 I236N probably benign Het
Cass4 G A 2: 172,416,187 G35E probably damaging Het
Chmp6 T C 11: 119,916,691 I120T probably benign Het
Col13a1 A G 10: 61,849,140 probably benign Het
Ddhd2 T A 8: 25,748,602 L328F probably damaging Het
Dnmt3l A G 10: 78,052,026 D123G possibly damaging Het
Eea1 T A 10: 96,002,948 V287E possibly damaging Het
Efcc1 A G 6: 87,731,182 N97S probably benign Het
Exd1 A G 2: 119,538,781 S118P probably benign Het
Ext2 G T 2: 93,811,972 T184K probably benign Het
Fam186a G A 15: 99,966,824 Q42* probably null Het
Gbp2 A T 3: 142,632,082 I320L probably benign Het
Gm15292 T A 8: 21,250,343 probably null Het
Gm5483 T A 16: 36,184,261 M1K probably null Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
H2-Q5 T C 17: 35,394,139 M5T unknown Het
Jak3 C T 8: 71,678,700 L70F probably damaging Het
Lhpp G A 7: 132,705,635 V254M probably damaging Het
Lig1 T A 7: 13,296,258 V387E possibly damaging Het
Lipo1 T C 19: 33,777,693 probably benign Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Narf T C 11: 121,244,654 Y111H probably damaging Het
Ncf4 A G 15: 78,250,977 K78R probably benign Het
Nrap A T 19: 56,342,169 C1118* probably null Het
Nubp2 A G 17: 24,885,798 V23A probably damaging Het
Olfr723 A T 14: 49,929,040 F168Y probably damaging Het
Olfr818 A T 10: 129,945,911 D50E possibly damaging Het
Olfr972 T C 9: 39,874,096 S274P possibly damaging Het
Pdzd7 G A 19: 45,036,989 P356S probably benign Het
Rttn T C 18: 89,037,946 V984A probably damaging Het
Ryr3 A G 2: 112,686,580 S3334P probably damaging Het
Senp7 G A 16: 56,139,105 probably null Het
Slc25a3 A C 10: 91,122,041 Y50D probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A T 15: 96,695,089 S163T probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stam2 A T 2: 52,720,910 C4* probably null Het
Taf1a A G 1: 183,395,934 D50G possibly damaging Het
Taf6l A T 19: 8,782,631 Y106N possibly damaging Het
Tbx20 G A 9: 24,725,520 Q424* probably null Het
Tex10 A G 4: 48,433,295 V829A possibly damaging Het
Tgfbr3 T C 5: 107,109,608 probably benign Het
Tnfsf10 G T 3: 27,335,593 V268F probably damaging Het
Trrap A G 5: 144,830,945 T2571A probably benign Het
Other mutations in AA986860
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:AA986860 APN 1 130742836 missense possibly damaging 0.69
IGL01761:AA986860 APN 1 130742722 missense possibly damaging 0.70
IGL02557:AA986860 APN 1 130742707 missense probably benign 0.02
IGL03003:AA986860 APN 1 130743772 missense probably damaging 1.00
IGL02802:AA986860 UTSW 1 130743393 missense probably benign 0.00
R0326:AA986860 UTSW 1 130742898 missense possibly damaging 0.87
R0483:AA986860 UTSW 1 130743825 missense probably damaging 1.00
R0906:AA986860 UTSW 1 130737693 splice site probably benign
R0932:AA986860 UTSW 1 130737693 splice site probably null
R1522:AA986860 UTSW 1 130743094 missense probably damaging 1.00
R1762:AA986860 UTSW 1 130737688 critical splice donor site probably null
R1874:AA986860 UTSW 1 130742691 missense probably benign 0.06
R2083:AA986860 UTSW 1 130741069 missense probably damaging 1.00
R2091:AA986860 UTSW 1 130743169 missense probably benign 0.01
R2093:AA986860 UTSW 1 130743304 missense probably benign 0.13
R3546:AA986860 UTSW 1 130741189 splice site probably benign
R3915:AA986860 UTSW 1 130742607 missense probably benign
R4679:AA986860 UTSW 1 130742403 missense possibly damaging 0.67
R4703:AA986860 UTSW 1 130743355 missense probably benign 0.19
R4890:AA986860 UTSW 1 130740988 splice site probably benign
R4988:AA986860 UTSW 1 130742710 missense probably damaging 1.00
R5171:AA986860 UTSW 1 130742847 missense probably benign 0.23
R5327:AA986860 UTSW 1 130741003 missense probably damaging 1.00
R5424:AA986860 UTSW 1 130742941 missense probably damaging 1.00
R5763:AA986860 UTSW 1 130743031 missense possibly damaging 0.53
R6247:AA986860 UTSW 1 130743043 missense possibly damaging 0.78
R7124:AA986860 UTSW 1 130742887 missense possibly damaging 0.67
R7747:AA986860 UTSW 1 130743547 missense possibly damaging 0.60
Z1176:AA986860 UTSW 1 130742991 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACAGAGTGACAGCAGCTACG -3'
(R):5'- CAGTACATGAGGTAGCCTATCAC -3'

Sequencing Primer
(F):5'- CGACTTCCTGTCTGCTGAAGAAAAG -3'
(R):5'- GGAGCCAGGCAAACTCCTTTC -3'
Posted On2016-12-15