Mutagenetix > Incidental Mutation

Incidental Mutation 'R0545:Itch'

44738

Institutional Source

Beutler Lab

Gene Symbol

Itch

Ensembl Gene

ENSMUSG00000027598

Gene Name

itchy, E3 ubiquitin protein ligase

Synonyms

8030492O04Rik, C230047C07Rik, 6720481N21Rik, AIP4

MMRRC Submission

038737-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

155133509-155226855 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 155182298 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 274 (G274*)

Ref Sequence

ENSEMBL: ENSMUSP00000105307 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029126] [ENSMUST00000109685]

AlphaFold

Q8C863

Predicted Effect

probably null
Transcript: ENSMUST00000029126
AA Change: G274*

SMART Domains

Protein: ENSMUSP00000029126
Gene: ENSMUSG00000027598
AA Change: G274*

Domain	Start	End	E-Value	Type
C2	19	114	3.56e-12	SMART
low complexity region	195	206	N/A	INTRINSIC
low complexity region	209	226	N/A	INTRINSIC
low complexity region	230	259	N/A	INTRINSIC
WW	288	320	1.07e-12	SMART
WW	321	352	3.86e-10	SMART
WW	400	432	7.36e-16	SMART
WW	440	472	6.82e-11	SMART
HECTc	528	864	7.04e-179	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109685
AA Change: G274*

SMART Domains

Protein: ENSMUSP00000105307
Gene: ENSMUSG00000027598
AA Change: G274*

Domain	Start	End	E-Value	Type
C2	19	114	3.56e-12	SMART
low complexity region	195	206	N/A	INTRINSIC
low complexity region	209	226	N/A	INTRINSIC
low complexity region	230	259	N/A	INTRINSIC
WW	288	320	1.07e-12	SMART
WW	321	352	3.86e-10	SMART
WW	400	432	7.36e-16	SMART
WW	440	472	6.82e-11	SMART
HECTc	528	864	7.04e-179	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142147

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.9%
20x: 94.0%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit increased total IgE levels in the peripheral blood and an enhanced IgE response to the cysteine protease allergen, papain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	C	T	2: 19,542,376	R76H	probably damaging	Het
4932438A13Rik	G	A	3: 36,987,690		probably benign	Het
Adnp2	T	C	18: 80,129,401	I598V	probably benign	Het
Ago3	T	C	4: 126,417,232	N63D	probably damaging	Het
Alkbh7	C	T	17: 56,999,012	R138*	probably null	Het
Atp6ap1l	T	C	13: 90,883,663	H300R	probably benign	Het
BC051076	C	T	5: 87,963,490		noncoding transcript	Het
Bpifb9a	T	A	2: 154,261,950	C104*	probably null	Het
Cacna2d2	T	C	9: 107,525,223	L826P	probably damaging	Het
Car5b	G	A	X: 163,979,301	R282C	probably damaging	Het
Ccdc88c	T	C	12: 100,947,188	D526G	probably damaging	Het
Cdh23	T	A	10: 60,331,291	T1861S	probably benign	Het
Ces2f	A	C	8: 104,950,036	M121L	possibly damaging	Het
Cfap58	G	A	19: 47,941,097		probably benign	Het
Chpf2	T	C	5: 24,590,324	S282P	possibly damaging	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Cma2	A	T	14: 55,973,113	M86L	probably benign	Het
Cog6	A	T	3: 52,996,075	M134K	probably damaging	Het
Col1a1	A	G	11: 94,951,594	D1446G	unknown	Het
Cpne8	T	A	15: 90,497,075	D512V	probably damaging	Het
Ctnna2	T	A	6: 77,605,182	N352I	probably damaging	Het
Cyp2c69	A	C	19: 39,886,661	L16R	probably damaging	Het
Dysf	T	C	6: 84,099,461	S603P	probably damaging	Het
Epha5	A	G	5: 84,067,358		probably null	Het
Ercc3	T	C	18: 32,245,902	S270P	probably damaging	Het
F10	T	A	8: 13,048,249	C151S	probably damaging	Het
Gpr180	T	G	14: 118,160,046	H317Q	possibly damaging	Het
Gstp2	T	C	19: 4,041,633	E32G	possibly damaging	Het
Ikzf5	T	C	7: 131,392,500	T133A	possibly damaging	Het
Jarid2	T	A	13: 44,902,831	N365K	probably benign	Het
Lama3	T	A	18: 12,561,701	S1295T	possibly damaging	Het
Lipc	A	G	9: 70,812,705	L255P	probably damaging	Het
Lrrc38	A	G	4: 143,350,758	D197G	probably benign	Het
Mfap2	A	G	4: 141,014,185		probably benign	Het
Mfhas1	A	G	8: 35,589,048	K226E	probably damaging	Het
Morc1	A	G	16: 48,565,657	R548G	probably benign	Het
Mrgprb5	T	C	7: 48,168,885	N34S	probably benign	Het
Mroh4	T	C	15: 74,625,427	T182A	probably benign	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Myo5a	T	C	9: 75,167,037	F743L	possibly damaging	Het
Notch4	A	C	17: 34,583,433	D1276A	probably damaging	Het
Olfr139	A	G	11: 74,045,047	C76R	possibly damaging	Het
Olfr215	T	A	6: 116,582,656	I97L	probably benign	Het
Olfr394	A	T	11: 73,888,017	Y118*	probably null	Het
Olfr799	T	A	10: 129,647,349	C74S	probably damaging	Het
Plin4	T	A	17: 56,106,567	T353S	probably damaging	Het
Ppp1r9a	A	G	6: 5,115,357	T827A	probably benign	Het
Prlr	C	T	15: 10,317,566	T40I	probably damaging	Het
Psme3	T	C	11: 101,319,904		probably benign	Het
Pygb	A	T	2: 150,815,706	D363V	probably benign	Het
Rsph6a	C	T	7: 19,054,946	Q68*	probably null	Het
Serpini2	A	G	3: 75,258,138	V178A	probably benign	Het
Sh2d2a	T	C	3: 87,851,888		probably benign	Het
Skint7	A	C	4: 111,980,198	M58L	probably benign	Het
Slco3a1	G	T	7: 74,320,553	Y435*	probably null	Het
Stk17b	T	C	1: 53,762,583		probably benign	Het
Tinag	T	A	9: 77,031,710	H162L	possibly damaging	Het
Ttc21a	T	A	9: 119,958,799	L811Q	probably damaging	Het
Ttc41	A	T	10: 86,759,097	M912L	probably benign	Het
Vmn2r98	G	T	17: 19,053,613	V41F	probably benign	Het
Washc5	C	T	15: 59,342,093	C838Y	possibly damaging	Het
Wrnip1	A	G	13: 32,806,813	T352A	probably damaging	Het
Zan	A	C	5: 137,396,177	C4467G	unknown	Het
Zc3h7a	T	C	16: 11,152,333		probably benign	Het
Zfp729a	C	A	13: 67,620,226	C628F	probably benign	Het

Other mutations in Itch

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Itch	APN	2	155213023	missense	probably damaging	1.00
IGL00796:Itch	APN	2	155209082	missense	probably damaging	0.97
IGL01090:Itch	APN	2	155206336	missense	probably damaging	0.99
IGL01568:Itch	APN	2	155212462	splice site	probably benign
IGL01844:Itch	APN	2	155172547	missense	possibly damaging	0.56
IGL01844:Itch	APN	2	155172486	missense	possibly damaging	0.94
IGL01873:Itch	APN	2	155168750	missense	possibly damaging	0.68
IGL02129:Itch	APN	2	155217988	splice site	probably benign
IGL02386:Itch	APN	2	155202261	nonsense	probably null
IGL02545:Itch	APN	2	155172586	splice site	probably null
IGL02621:Itch	APN	2	155172584	splice site	probably null
IGL02708:Itch	APN	2	155174044	missense	probably benign	0.00
IGL02869:Itch	APN	2	155173933	critical splice acceptor site	probably null
Abrade	UTSW	2	155209078	missense	possibly damaging	0.93
dorsolateral	UTSW	2	155210558	nonsense	probably null
gadfly	UTSW	2	155182298	nonsense	probably null
hankerin	UTSW	2	155210582	critical splice donor site	probably null
irresistable	UTSW	2	155203297	missense	probably benign	0.34
prurient	UTSW	2	155210502	missense	probably damaging	1.00
scratch	UTSW	2	155172561	missense	probably damaging	0.99
R0116:Itch	UTSW	2	155217983	splice site	probably benign
R0207:Itch	UTSW	2	155202257	missense	probably benign
R0226:Itch	UTSW	2	155199394	missense	probably benign	0.01
R0689:Itch	UTSW	2	155182178	missense	possibly damaging	0.82
R1365:Itch	UTSW	2	155213031	missense	probably benign	0.00
R1406:Itch	UTSW	2	155206354	missense	possibly damaging	0.95
R1406:Itch	UTSW	2	155206354	missense	possibly damaging	0.95
R1436:Itch	UTSW	2	155192145	missense	probably damaging	0.96
R1639:Itch	UTSW	2	155179025	splice site	probably null
R1769:Itch	UTSW	2	155172561	missense	probably damaging	0.99
R1855:Itch	UTSW	2	155172454	splice site	probably benign
R1865:Itch	UTSW	2	155168746	missense	probably damaging	0.96
R2008:Itch	UTSW	2	155210459	missense	possibly damaging	0.91
R2054:Itch	UTSW	2	155210576	missense	probably damaging	1.00
R2196:Itch	UTSW	2	155202221	missense	probably benign
R2199:Itch	UTSW	2	155202221	missense	probably benign
R2252:Itch	UTSW	2	155212339	missense	probably benign	0.01
R2253:Itch	UTSW	2	155212339	missense	probably benign	0.01
R2348:Itch	UTSW	2	155209078	missense	possibly damaging	0.93
R2850:Itch	UTSW	2	155202221	missense	probably benign
R3021:Itch	UTSW	2	155209126	missense	possibly damaging	0.74
R4676:Itch	UTSW	2	155199435	missense	probably benign	0.05
R4716:Itch	UTSW	2	155210582	critical splice donor site	probably null
R4888:Itch	UTSW	2	155217977	splice site	probably null
R4970:Itch	UTSW	2	155185593	missense	possibly damaging	0.50
R6029:Itch	UTSW	2	155179089	critical splice donor site	probably null
R6122:Itch	UTSW	2	155174065	missense	probably benign	0.05
R6435:Itch	UTSW	2	155209129	missense	probably benign	0.01
R6449:Itch	UTSW	2	155163395	splice site	probably benign
R7069:Itch	UTSW	2	155209994	missense	probably damaging	1.00
R7083:Itch	UTSW	2	155210444	missense	probably damaging	1.00
R7409:Itch	UTSW	2	155199382	missense	probably damaging	0.99
R7689:Itch	UTSW	2	155210002	missense	probably damaging	0.99
R7689:Itch	UTSW	2	155213067	missense	probably benign	0.00
R7974:Itch	UTSW	2	155192159	missense	probably damaging	1.00
R8046:Itch	UTSW	2	155210502	missense	probably damaging	1.00
R8248:Itch	UTSW	2	155206383	critical splice donor site	probably null
R8355:Itch	UTSW	2	155210582	critical splice donor site	probably null
R8428:Itch	UTSW	2	155168707	missense	probably benign	0.38
R8691:Itch	UTSW	2	155210558	nonsense	probably null
R8779:Itch	UTSW	2	155172520	missense	probably benign	0.28
R9010:Itch	UTSW	2	155179071	missense	probably benign
R9130:Itch	UTSW	2	155210125	splice site	probably benign
R9278:Itch	UTSW	2	155203297	missense	probably benign	0.34
Z1177:Itch	UTSW	2	155209059	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACTTTGTATAGCTTCTGTCAATGGCTCACC -3'
(R):5'- CACAGTTTGTTCCTTTCACAGTTTTGCtt -3'

Sequencing Primer
(F):5'- CATCCACGAATTCTGACAGTG -3'
(R):5'- tgggcagtagaggtagagg -3'

Posted On

2013-06-11