Incidental Mutation 'R5799:Stam2'
ID447381
Institutional Source Beutler Lab
Gene Symbol Stam2
Ensembl Gene ENSMUSG00000055371
Gene Namesignal transducing adaptor molecule (SH3 domain and ITAM motif) 2
SynonymsHbp, 1200004O12Rik, 5730456G07Rik
MMRRC Submission 043388-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5799 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location52691664-52742281 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 52720910 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 4 (C4*)
Ref Sequence ENSEMBL: ENSMUSP00000114620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102759] [ENSMUST00000127316] [ENSMUST00000138290] [ENSMUST00000155516]
Predicted Effect probably null
Transcript: ENSMUST00000102759
AA Change: C33*
SMART Domains Protein: ENSMUSP00000099820
Gene: ENSMUSG00000055371
AA Change: C33*

DomainStartEndE-ValueType
VHS 9 140 6.36e-57 SMART
UIM 165 184 3.24e-3 SMART
SH3 205 260 5.69e-21 SMART
Pfam:GAT 294 367 2.3e-8 PFAM
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127316
AA Change: C33*
SMART Domains Protein: ENSMUSP00000121898
Gene: ENSMUSG00000055371
AA Change: C33*

DomainStartEndE-ValueType
Pfam:VHS 4 70 8.5e-20 PFAM
UIM 132 151 3.24e-3 SMART
SH3 172 227 5.69e-21 SMART
PDB:3F1I|C 258 334 4e-29 PDB
Predicted Effect probably null
Transcript: ENSMUST00000138290
AA Change: C4*
SMART Domains Protein: ENSMUSP00000114620
Gene: ENSMUSG00000055371
AA Change: C4*

DomainStartEndE-ValueType
Pfam:VHS 1 65 7.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150582
Predicted Effect probably benign
Transcript: ENSMUST00000155516
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 89% (51/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is closely related to STAM, an adaptor protein involved in the downstream signaling of cytokine receptors, both of which contain a SH3 domain and the immunoreceptor tyrosine-based activation motif (ITAM). Similar to STAM, this protein acts downstream of JAK kinases, and is phosphorylated in response to cytokine stimulation. This protein and STAM thus are thought to exhibit compensatory effects on the signaling pathway downstream of JAK kinases upon cytokine stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal lymphocyte responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,769 E284G probably damaging Het
AA986860 C T 1: 130,741,171 Q92* probably null Het
Accsl T C 2: 93,864,403 probably null Het
Ahnak2 T C 12: 112,778,930 probably benign Het
Alcam T C 16: 52,309,849 D46G probably benign Het
Asap2 T C 12: 21,168,246 S57P probably damaging Het
Atg14 A T 14: 47,547,295 V314D possibly damaging Het
C230029F24Rik C T 1: 49,338,148 noncoding transcript Het
Calcr A T 6: 3,707,592 I236N probably benign Het
Cass4 G A 2: 172,416,187 G35E probably damaging Het
Chmp6 T C 11: 119,916,691 I120T probably benign Het
Col13a1 A G 10: 61,849,140 probably benign Het
Ddhd2 T A 8: 25,748,602 L328F probably damaging Het
Dnmt3l A G 10: 78,052,026 D123G possibly damaging Het
Eea1 T A 10: 96,002,948 V287E possibly damaging Het
Efcc1 A G 6: 87,731,182 N97S probably benign Het
Exd1 A G 2: 119,538,781 S118P probably benign Het
Ext2 G T 2: 93,811,972 T184K probably benign Het
Fam186a G A 15: 99,966,824 Q42* probably null Het
Gbp2 A T 3: 142,632,082 I320L probably benign Het
Gm15292 T A 8: 21,250,343 probably null Het
Gm5483 T A 16: 36,184,261 M1K probably null Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
H2-Q5 T C 17: 35,394,139 M5T unknown Het
Jak3 C T 8: 71,678,700 L70F probably damaging Het
Lhpp G A 7: 132,705,635 V254M probably damaging Het
Lig1 T A 7: 13,296,258 V387E possibly damaging Het
Lipo1 T C 19: 33,777,693 probably benign Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Narf T C 11: 121,244,654 Y111H probably damaging Het
Ncf4 A G 15: 78,250,977 K78R probably benign Het
Nrap A T 19: 56,342,169 C1118* probably null Het
Nubp2 A G 17: 24,885,798 V23A probably damaging Het
Olfr723 A T 14: 49,929,040 F168Y probably damaging Het
Olfr818 A T 10: 129,945,911 D50E possibly damaging Het
Olfr972 T C 9: 39,874,096 S274P possibly damaging Het
Pdzd7 G A 19: 45,036,989 P356S probably benign Het
Rttn T C 18: 89,037,946 V984A probably damaging Het
Ryr3 A G 2: 112,686,580 S3334P probably damaging Het
Senp7 G A 16: 56,139,105 probably null Het
Slc25a3 A C 10: 91,122,041 Y50D probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A T 15: 96,695,089 S163T probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Taf1a A G 1: 183,395,934 D50G possibly damaging Het
Taf6l A T 19: 8,782,631 Y106N possibly damaging Het
Tbx20 G A 9: 24,725,520 Q424* probably null Het
Tex10 A G 4: 48,433,295 V829A possibly damaging Het
Tgfbr3 T C 5: 107,109,608 probably benign Het
Tnfsf10 G T 3: 27,335,593 V268F probably damaging Het
Trrap A G 5: 144,830,945 T2571A probably benign Het
Other mutations in Stam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Stam2 APN 2 52706406 missense possibly damaging 0.80
IGL00471:Stam2 APN 2 52720935 missense probably damaging 1.00
IGL01480:Stam2 APN 2 52716439 missense probably benign
IGL01731:Stam2 APN 2 52708150 missense probably damaging 0.99
IGL02684:Stam2 APN 2 52719935 missense probably damaging 1.00
IGL02893:Stam2 APN 2 52714902 missense probably damaging 1.00
IGL02900:Stam2 APN 2 52708197 missense probably benign
R0110:Stam2 UTSW 2 52719986 splice site probably benign
R0257:Stam2 UTSW 2 52694782 missense possibly damaging 0.90
R0539:Stam2 UTSW 2 52703256 splice site probably benign
R1432:Stam2 UTSW 2 52714809 splice site probably benign
R1699:Stam2 UTSW 2 52703175 missense possibly damaging 0.55
R1822:Stam2 UTSW 2 52716527 missense probably damaging 1.00
R1956:Stam2 UTSW 2 52708227 critical splice acceptor site probably null
R1984:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1985:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1986:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1993:Stam2 UTSW 2 52703156 nonsense probably null
R2179:Stam2 UTSW 2 52694924 missense probably benign 0.00
R2181:Stam2 UTSW 2 52703144 missense probably benign 0.00
R4617:Stam2 UTSW 2 52715704 missense probably benign 0.00
R4723:Stam2 UTSW 2 52720950 missense probably benign 0.10
R5217:Stam2 UTSW 2 52736293 intron probably benign
R5218:Stam2 UTSW 2 52736293 intron probably benign
R5219:Stam2 UTSW 2 52736293 intron probably benign
R5366:Stam2 UTSW 2 52736293 intron probably benign
R5368:Stam2 UTSW 2 52736293 intron probably benign
R5420:Stam2 UTSW 2 52736293 intron probably benign
R5447:Stam2 UTSW 2 52736293 intron probably benign
R5490:Stam2 UTSW 2 52720917 missense probably damaging 1.00
R5861:Stam2 UTSW 2 52742104 utr 5 prime probably benign
R6039:Stam2 UTSW 2 52709599 missense probably benign
R6039:Stam2 UTSW 2 52709599 missense probably benign
R6490:Stam2 UTSW 2 52720942 missense probably benign 0.00
R6552:Stam2 UTSW 2 52708227 critical splice acceptor site probably null
R6792:Stam2 UTSW 2 52707981 missense probably benign
R7787:Stam2 UTSW 2 52706406 missense probably benign 0.01
R8042:Stam2 UTSW 2 52706397 critical splice donor site probably null
R8050:Stam2 UTSW 2 52719773 missense probably damaging 1.00
R8074:Stam2 UTSW 2 52706426 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACCAGATTTTCAATGAACACTGC -3'
(R):5'- AGATAGTAGAAGTGTACTCTTTTCTGG -3'

Sequencing Primer
(F):5'- TATAAAACCTAGCCTACTGGAACG -3'
(R):5'- CTGGAATTTATCCTTAGTTCTCT -3'
Posted On2016-12-15