Incidental Mutation 'R5799:Cass4'
ID447387
Institutional Source Beutler Lab
Gene Symbol Cass4
Ensembl Gene ENSMUSG00000074570
Gene NameCas scaffolding protein family member 4
SynonymsF730031O20Rik
MMRRC Submission 043388-MU
Accession Numbers

Ncbi RefSeq: NM_001033538.2, NM_001080820.1; MGI:2444482

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5799 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172393794-172433757 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 172416187 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 35 (G35E)
Ref Sequence ENSEMBL: ENSMUSP00000154073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099061] [ENSMUST00000103073] [ENSMUST00000109136] [ENSMUST00000228775]
Predicted Effect probably damaging
Transcript: ENSMUST00000099061
AA Change: G35E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096660
Gene: ENSMUSG00000074570
AA Change: G35E

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 4.2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103073
AA Change: G35E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099362
Gene: ENSMUSG00000074570
AA Change: G35E

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 7.5e-69 PFAM
Pfam:DUF3513 587 778 8.8e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109136
AA Change: G35E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104764
Gene: ENSMUSG00000074570
AA Change: G35E

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 589 3.8e-58 PFAM
Pfam:DUF3513 593 803 1.6e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228775
AA Change: G35E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7561 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 89% (51/57)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,769 E284G probably damaging Het
AA986860 C T 1: 130,741,171 Q92* probably null Het
Accsl T C 2: 93,864,403 probably null Het
Ahnak2 T C 12: 112,778,930 probably benign Het
Alcam T C 16: 52,309,849 D46G probably benign Het
Asap2 T C 12: 21,168,246 S57P probably damaging Het
Atg14 A T 14: 47,547,295 V314D possibly damaging Het
C230029F24Rik C T 1: 49,338,148 noncoding transcript Het
Calcr A T 6: 3,707,592 I236N probably benign Het
Chmp6 T C 11: 119,916,691 I120T probably benign Het
Col13a1 A G 10: 61,849,140 probably benign Het
Ddhd2 T A 8: 25,748,602 L328F probably damaging Het
Dnmt3l A G 10: 78,052,026 D123G possibly damaging Het
Eea1 T A 10: 96,002,948 V287E possibly damaging Het
Efcc1 A G 6: 87,731,182 N97S probably benign Het
Exd1 A G 2: 119,538,781 S118P probably benign Het
Ext2 G T 2: 93,811,972 T184K probably benign Het
Fam186a G A 15: 99,966,824 Q42* probably null Het
Gbp2 A T 3: 142,632,082 I320L probably benign Het
Gm15292 T A 8: 21,250,343 probably null Het
Gm5483 T A 16: 36,184,261 M1K probably null Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
H2-Q5 T C 17: 35,394,139 M5T unknown Het
Jak3 C T 8: 71,678,700 L70F probably damaging Het
Lhpp G A 7: 132,705,635 V254M probably damaging Het
Lig1 T A 7: 13,296,258 V387E possibly damaging Het
Lipo1 T C 19: 33,777,693 probably benign Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Narf T C 11: 121,244,654 Y111H probably damaging Het
Ncf4 A G 15: 78,250,977 K78R probably benign Het
Nrap A T 19: 56,342,169 C1118* probably null Het
Nubp2 A G 17: 24,885,798 V23A probably damaging Het
Olfr723 A T 14: 49,929,040 F168Y probably damaging Het
Olfr818 A T 10: 129,945,911 D50E possibly damaging Het
Olfr972 T C 9: 39,874,096 S274P possibly damaging Het
Pdzd7 G A 19: 45,036,989 P356S probably benign Het
Rttn T C 18: 89,037,946 V984A probably damaging Het
Ryr3 A G 2: 112,686,580 S3334P probably damaging Het
Senp7 G A 16: 56,139,105 probably null Het
Slc25a3 A C 10: 91,122,041 Y50D probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A T 15: 96,695,089 S163T probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stam2 A T 2: 52,720,910 C4* probably null Het
Taf1a A G 1: 183,395,934 D50G possibly damaging Het
Taf6l A T 19: 8,782,631 Y106N possibly damaging Het
Tbx20 G A 9: 24,725,520 Q424* probably null Het
Tex10 A G 4: 48,433,295 V829A possibly damaging Het
Tgfbr3 T C 5: 107,109,608 probably benign Het
Tnfsf10 G T 3: 27,335,593 V268F probably damaging Het
Trrap A G 5: 144,830,945 T2571A probably benign Het
Other mutations in Cass4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cass4 APN 2 172416250 missense probably damaging 1.00
IGL00846:Cass4 APN 2 172429723 intron probably benign
IGL01400:Cass4 APN 2 172427300 missense probably damaging 1.00
IGL01985:Cass4 APN 2 172427206 missense probably damaging 1.00
IGL02268:Cass4 APN 2 172427042 missense possibly damaging 0.76
IGL02592:Cass4 APN 2 172416328 missense probably benign 0.00
R0030:Cass4 UTSW 2 172427842 nonsense probably null
R0035:Cass4 UTSW 2 172416492 missense probably damaging 1.00
R0039:Cass4 UTSW 2 172426980 missense probably damaging 1.00
R0631:Cass4 UTSW 2 172432411 missense probably damaging 1.00
R1321:Cass4 UTSW 2 172424652 missense probably benign 0.05
R1352:Cass4 UTSW 2 172416495 missense probably damaging 0.98
R1612:Cass4 UTSW 2 172427078 missense possibly damaging 0.46
R1720:Cass4 UTSW 2 172427734 missense probably damaging 0.99
R1776:Cass4 UTSW 2 172427695 missense probably benign
R1918:Cass4 UTSW 2 172427339 missense possibly damaging 0.69
R2257:Cass4 UTSW 2 172427470 missense probably damaging 1.00
R2257:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R2262:Cass4 UTSW 2 172427254 missense probably damaging 1.00
R2924:Cass4 UTSW 2 172426672 missense possibly damaging 0.89
R3498:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3499:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3792:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3793:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3901:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R4899:Cass4 UTSW 2 172427869 missense probably benign
R5161:Cass4 UTSW 2 172432324 missense probably damaging 1.00
R5534:Cass4 UTSW 2 172426768 missense probably benign 0.13
R5646:Cass4 UTSW 2 172416245 missense probably damaging 1.00
R5873:Cass4 UTSW 2 172426768 missense probably benign 0.13
R6084:Cass4 UTSW 2 172426912 missense probably benign 0.01
R6360:Cass4 UTSW 2 172432611 missense probably damaging 1.00
R6432:Cass4 UTSW 2 172427719 missense probably damaging 1.00
R7116:Cass4 UTSW 2 172427969 missense unknown
R7212:Cass4 UTSW 2 172427186 nonsense probably null
R7549:Cass4 UTSW 2 172426798 missense probably benign 0.01
R7549:Cass4 UTSW 2 172426799 missense probably benign 0.00
R7594:Cass4 UTSW 2 172429648 missense probably benign 0.03
R7659:Cass4 UTSW 2 172427027 missense probably damaging 1.00
R8003:Cass4 UTSW 2 172427959 missense unknown
R8270:Cass4 UTSW 2 172427669 missense probably damaging 1.00
R8296:Cass4 UTSW 2 172427174 missense probably benign 0.28
R8378:Cass4 UTSW 2 172427794 missense probably benign 0.05
Z1177:Cass4 UTSW 2 172427575 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTGGAGACTTGTGCTGC -3'
(R):5'- ATTGGTTCATACACAGGTCCC -3'

Sequencing Primer
(F):5'- GAGACTTGTGCTGCAGTTTC -3'
(R):5'- GATCAAGTCCTGCACCTGGTAAG -3'
Posted On2016-12-15