Incidental Mutation 'R5799:Lhpp'
ID447398
Institutional Source Beutler Lab
Gene Symbol Lhpp
Ensembl Gene ENSMUSG00000030946
Gene Namephospholysine phosphohistidine inorganic pyrophosphate phosphatase
Synonyms
MMRRC Submission 043388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R5799 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location132610638-132706420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132705635 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 254 (V254M)
Ref Sequence ENSEMBL: ENSMUSP00000033241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033241] [ENSMUST00000124096]
Predicted Effect probably damaging
Transcript: ENSMUST00000033241
AA Change: V254M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033241
Gene: ENSMUSG00000030946
AA Change: V254M

DomainStartEndE-ValueType
Pfam:Hydrolase 11 227 1.1e-8 PFAM
Pfam:Hydrolase_6 14 116 4.4e-17 PFAM
Pfam:HAD_2 159 233 3.4e-9 PFAM
Pfam:Hydrolase_like 186 260 9.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210168
Meta Mutation Damage Score 0.1972 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 89% (51/57)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,769 E284G probably damaging Het
AA986860 C T 1: 130,741,171 Q92* probably null Het
Accsl T C 2: 93,864,403 probably null Het
Ahnak2 T C 12: 112,778,930 probably benign Het
Alcam T C 16: 52,309,849 D46G probably benign Het
Asap2 T C 12: 21,168,246 S57P probably damaging Het
Atg14 A T 14: 47,547,295 V314D possibly damaging Het
C230029F24Rik C T 1: 49,338,148 noncoding transcript Het
Calcr A T 6: 3,707,592 I236N probably benign Het
Cass4 G A 2: 172,416,187 G35E probably damaging Het
Chmp6 T C 11: 119,916,691 I120T probably benign Het
Col13a1 A G 10: 61,849,140 probably benign Het
Ddhd2 T A 8: 25,748,602 L328F probably damaging Het
Dnmt3l A G 10: 78,052,026 D123G possibly damaging Het
Eea1 T A 10: 96,002,948 V287E possibly damaging Het
Efcc1 A G 6: 87,731,182 N97S probably benign Het
Exd1 A G 2: 119,538,781 S118P probably benign Het
Ext2 G T 2: 93,811,972 T184K probably benign Het
Fam186a G A 15: 99,966,824 Q42* probably null Het
Gbp2 A T 3: 142,632,082 I320L probably benign Het
Gm15292 T A 8: 21,250,343 probably null Het
Gm5483 T A 16: 36,184,261 M1K probably null Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
H2-Q5 T C 17: 35,394,139 M5T unknown Het
Jak3 C T 8: 71,678,700 L70F probably damaging Het
Lig1 T A 7: 13,296,258 V387E possibly damaging Het
Lipo1 T C 19: 33,777,693 probably benign Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Narf T C 11: 121,244,654 Y111H probably damaging Het
Ncf4 A G 15: 78,250,977 K78R probably benign Het
Nrap A T 19: 56,342,169 C1118* probably null Het
Nubp2 A G 17: 24,885,798 V23A probably damaging Het
Olfr723 A T 14: 49,929,040 F168Y probably damaging Het
Olfr818 A T 10: 129,945,911 D50E possibly damaging Het
Olfr972 T C 9: 39,874,096 S274P possibly damaging Het
Pdzd7 G A 19: 45,036,989 P356S probably benign Het
Rttn T C 18: 89,037,946 V984A probably damaging Het
Ryr3 A G 2: 112,686,580 S3334P probably damaging Het
Senp7 G A 16: 56,139,105 probably null Het
Slc25a3 A C 10: 91,122,041 Y50D probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A T 15: 96,695,089 S163T probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stam2 A T 2: 52,720,910 C4* probably null Het
Taf1a A G 1: 183,395,934 D50G possibly damaging Het
Taf6l A T 19: 8,782,631 Y106N possibly damaging Het
Tbx20 G A 9: 24,725,520 Q424* probably null Het
Tex10 A G 4: 48,433,295 V829A possibly damaging Het
Tgfbr3 T C 5: 107,109,608 probably benign Het
Tnfsf10 G T 3: 27,335,593 V268F probably damaging Het
Trrap A G 5: 144,830,945 T2571A probably benign Het
Other mutations in Lhpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Lhpp APN 7 132642520 missense probably damaging 1.00
IGL02695:Lhpp APN 7 132650334 missense probably damaging 1.00
IGL03220:Lhpp APN 7 132650291 missense probably benign 0.02
R0105:Lhpp UTSW 7 132630525 missense probably damaging 0.99
R0200:Lhpp UTSW 7 132610677 start gained probably benign
R0463:Lhpp UTSW 7 132610677 start gained probably benign
R1103:Lhpp UTSW 7 132610755 missense probably damaging 1.00
R1872:Lhpp UTSW 7 132634087 missense probably benign 0.24
R4816:Lhpp UTSW 7 132670375 nonsense probably null
R5140:Lhpp UTSW 7 132705632 missense probably damaging 0.99
R6816:Lhpp UTSW 7 132634033 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAACCCTGGCTCACTCTTG -3'
(R):5'- TAGCATCTGTCCTGGCAAAG -3'

Sequencing Primer
(F):5'- ACGCAGTGTCCTTGTGC -3'
(R):5'- GGCAAAGCCTTGGGTGG -3'
Posted On2016-12-15