Incidental Mutation 'R5799:Dnmt3l'
ID447406
Institutional Source Beutler Lab
Gene Symbol Dnmt3l
Ensembl Gene ENSMUSG00000000730
Gene NameDNA (cytosine-5-)-methyltransferase 3-like
SynonymsD6Ertd14e, ecat7
MMRRC Submission 043388-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5799 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78041947-78063622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78052026 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 123 (D123G)
Ref Sequence ENSEMBL: ENSMUSP00000116970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000746] [ENSMUST00000123940] [ENSMUST00000131825] [ENSMUST00000138785] [ENSMUST00000139539] [ENSMUST00000151242]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000746
AA Change: D123G

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000000746
Gene: ENSMUSG00000000730
AA Change: D123G

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123940
SMART Domains Protein: ENSMUSP00000123015
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000131825
SMART Domains Protein: ENSMUSP00000119571
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000138785
AA Change: D123G

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121562
Gene: ENSMUSG00000000730
AA Change: D123G

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139539
SMART Domains Protein: ENSMUSP00000117827
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144446
Predicted Effect possibly damaging
Transcript: ENSMUST00000151242
AA Change: D123G

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116970
Gene: ENSMUSG00000000730
AA Change: D123G

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Meta Mutation Damage Score 0.2664 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 89% (51/57)
MGI Phenotype FUNCTION: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein that is a catalytically inactive regulatory factor of DNA methyltransferases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutants in this imprinted gene lack appropriate methylation of the maternal allele and this, in turn, causes azoospermia in homozygous males; and heterozygous progeny of homozygous females die by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,769 E284G probably damaging Het
AA986860 C T 1: 130,741,171 Q92* probably null Het
Accsl T C 2: 93,864,403 probably null Het
Ahnak2 T C 12: 112,778,930 probably benign Het
Alcam T C 16: 52,309,849 D46G probably benign Het
Asap2 T C 12: 21,168,246 S57P probably damaging Het
Atg14 A T 14: 47,547,295 V314D possibly damaging Het
C230029F24Rik C T 1: 49,338,148 noncoding transcript Het
Calcr A T 6: 3,707,592 I236N probably benign Het
Cass4 G A 2: 172,416,187 G35E probably damaging Het
Chmp6 T C 11: 119,916,691 I120T probably benign Het
Col13a1 A G 10: 61,849,140 probably benign Het
Ddhd2 T A 8: 25,748,602 L328F probably damaging Het
Eea1 T A 10: 96,002,948 V287E possibly damaging Het
Efcc1 A G 6: 87,731,182 N97S probably benign Het
Exd1 A G 2: 119,538,781 S118P probably benign Het
Ext2 G T 2: 93,811,972 T184K probably benign Het
Fam186a G A 15: 99,966,824 Q42* probably null Het
Gbp2 A T 3: 142,632,082 I320L probably benign Het
Gm15292 T A 8: 21,250,343 probably null Het
Gm5483 T A 16: 36,184,261 M1K probably null Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
H2-Q5 T C 17: 35,394,139 M5T unknown Het
Jak3 C T 8: 71,678,700 L70F probably damaging Het
Lhpp G A 7: 132,705,635 V254M probably damaging Het
Lig1 T A 7: 13,296,258 V387E possibly damaging Het
Lipo1 T C 19: 33,777,693 probably benign Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Narf T C 11: 121,244,654 Y111H probably damaging Het
Ncf4 A G 15: 78,250,977 K78R probably benign Het
Nrap A T 19: 56,342,169 C1118* probably null Het
Nubp2 A G 17: 24,885,798 V23A probably damaging Het
Olfr723 A T 14: 49,929,040 F168Y probably damaging Het
Olfr818 A T 10: 129,945,911 D50E possibly damaging Het
Olfr972 T C 9: 39,874,096 S274P possibly damaging Het
Pdzd7 G A 19: 45,036,989 P356S probably benign Het
Rttn T C 18: 89,037,946 V984A probably damaging Het
Ryr3 A G 2: 112,686,580 S3334P probably damaging Het
Senp7 G A 16: 56,139,105 probably null Het
Slc25a3 A C 10: 91,122,041 Y50D probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A T 15: 96,695,089 S163T probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stam2 A T 2: 52,720,910 C4* probably null Het
Taf1a A G 1: 183,395,934 D50G possibly damaging Het
Taf6l A T 19: 8,782,631 Y106N possibly damaging Het
Tbx20 G A 9: 24,725,520 Q424* probably null Het
Tex10 A G 4: 48,433,295 V829A possibly damaging Het
Tgfbr3 T C 5: 107,109,608 probably benign Het
Tnfsf10 G T 3: 27,335,593 V268F probably damaging Het
Trrap A G 5: 144,830,945 T2571A probably benign Het
Other mutations in Dnmt3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dnmt3l APN 10 78057355 missense probably damaging 1.00
IGL00827:Dnmt3l APN 10 78053996 missense probably damaging 1.00
IGL01072:Dnmt3l APN 10 78052771 missense probably benign 0.09
IGL01118:Dnmt3l APN 10 78057286 missense probably damaging 0.97
IGL01553:Dnmt3l APN 10 78063248 missense probably benign 0.00
IGL02322:Dnmt3l APN 10 78052738 missense possibly damaging 0.90
IGL02323:Dnmt3l APN 10 78063318 missense probably damaging 1.00
IGL02618:Dnmt3l APN 10 78054022 splice site probably benign
IGL02701:Dnmt3l APN 10 78055022 missense probably benign 0.01
IGL02950:Dnmt3l APN 10 78050951 missense probably benign 0.01
R0318:Dnmt3l UTSW 10 78055055 missense probably damaging 1.00
R0384:Dnmt3l UTSW 10 78052737 missense possibly damaging 0.95
R0391:Dnmt3l UTSW 10 78051916 splice site probably benign
R1144:Dnmt3l UTSW 10 78051905 missense probably damaging 1.00
R2069:Dnmt3l UTSW 10 78052732 missense probably damaging 1.00
R2115:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R2116:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R2117:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R4812:Dnmt3l UTSW 10 78057294 missense probably benign 0.06
R5001:Dnmt3l UTSW 10 78059731 missense probably null 1.00
R5039:Dnmt3l UTSW 10 78052900 splice site probably null
R5389:Dnmt3l UTSW 10 78056831 splice site probably null
R5811:Dnmt3l UTSW 10 78052095 missense possibly damaging 0.78
R5875:Dnmt3l UTSW 10 78053938 missense probably benign
R6314:Dnmt3l UTSW 10 78059687 missense probably benign 0.00
R6537:Dnmt3l UTSW 10 78052064 missense probably null 1.00
R8437:Dnmt3l UTSW 10 78052768 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGAACTCTCCAGGTGTACACTC -3'
(R):5'- AATGGCTGAATGGTGGCTGC -3'

Sequencing Primer
(F):5'- TCCAGGTGTACACTCGGCAC -3'
(R):5'- TGCTTGTGAAGAAAGGCATCCC -3'
Posted On2016-12-15