Incidental Mutation 'R0545:Serpini2'
ID 44741
Institutional Source Beutler Lab
Gene Symbol Serpini2
Ensembl Gene ENSMUSG00000034139
Gene Name serine (or cysteine) peptidase inhibitor, clade I, member 2
Synonyms 1810006A24Rik
MMRRC Submission 038737-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R0545 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 75149677-75177385 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75165445 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 178 (V178A)
Ref Sequence ENSEMBL: ENSMUSP00000046943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039047]
AlphaFold Q9JK88
Predicted Effect probably benign
Transcript: ENSMUST00000039047
AA Change: V178A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000046943
Gene: ENSMUSG00000034139
AA Change: V178A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 31 392 8.75e-130 SMART
Meta Mutation Damage Score 0.2726 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of a family of proteins that acts as inhibitors of serine proteases. These proteins function in the regulation of a variety of physiological processes, including coagulation, fibrinolysis, development, malignancy, and inflammation. Expression of the encoded protein may be downregulated during pancreatic carcinogenesis. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgene insertion/deletion encompassing this gene display pancreatic insufficiency characterized by progressive apoptosis of pancreatic acinar cells, postnatal growth retardation, immunological anomalies, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,547,187 (GRCm39) R76H probably damaging Het
Adnp2 T C 18: 80,172,616 (GRCm39) I598V probably benign Het
Ago3 T C 4: 126,311,025 (GRCm39) N63D probably damaging Het
Alkbh7 C T 17: 57,306,012 (GRCm39) R138* probably null Het
Atp6ap1l T C 13: 91,031,782 (GRCm39) H300R probably benign Het
BC051076 C T 5: 88,111,349 (GRCm39) noncoding transcript Het
Bltp1 G A 3: 37,041,839 (GRCm39) probably benign Het
Bpifb9a T A 2: 154,103,870 (GRCm39) C104* probably null Het
Cacna2d2 T C 9: 107,402,422 (GRCm39) L826P probably damaging Het
Car5b G A X: 162,762,297 (GRCm39) R282C probably damaging Het
Ccdc88c T C 12: 100,913,447 (GRCm39) D526G probably damaging Het
Cdh23 T A 10: 60,167,070 (GRCm39) T1861S probably benign Het
Ces2f A C 8: 105,676,668 (GRCm39) M121L possibly damaging Het
Cfap58 G A 19: 47,929,536 (GRCm39) probably benign Het
Chpf2 T C 5: 24,795,322 (GRCm39) S282P possibly damaging Het
Cluap1 C T 16: 3,751,636 (GRCm39) R332W probably damaging Het
Cma2 A T 14: 56,210,570 (GRCm39) M86L probably benign Het
Cog6 A T 3: 52,903,496 (GRCm39) M134K probably damaging Het
Col1a1 A G 11: 94,842,420 (GRCm39) D1446G unknown Het
Cpne8 T A 15: 90,381,278 (GRCm39) D512V probably damaging Het
Ctnna2 T A 6: 77,582,165 (GRCm39) N352I probably damaging Het
Cyp2c69 A C 19: 39,875,105 (GRCm39) L16R probably damaging Het
Dysf T C 6: 84,076,443 (GRCm39) S603P probably damaging Het
Epha5 A G 5: 84,215,217 (GRCm39) probably null Het
Ercc3 T C 18: 32,378,955 (GRCm39) S270P probably damaging Het
F10 T A 8: 13,098,249 (GRCm39) C151S probably damaging Het
Gpr180 T G 14: 118,397,458 (GRCm39) H317Q possibly damaging Het
Gstp2 T C 19: 4,091,633 (GRCm39) E32G possibly damaging Het
Ikzf5 T C 7: 130,994,229 (GRCm39) T133A possibly damaging Het
Itch G T 2: 155,024,218 (GRCm39) G274* probably null Het
Jarid2 T A 13: 45,056,307 (GRCm39) N365K probably benign Het
Lama3 T A 18: 12,694,758 (GRCm39) S1295T possibly damaging Het
Lipc A G 9: 70,719,987 (GRCm39) L255P probably damaging Het
Lrrc38 A G 4: 143,077,328 (GRCm39) D197G probably benign Het
Mfap2 A G 4: 140,741,496 (GRCm39) probably benign Het
Mfhas1 A G 8: 36,056,202 (GRCm39) K226E probably damaging Het
Morc1 A G 16: 48,386,020 (GRCm39) R548G probably benign Het
Mrgprb5 T C 7: 47,818,633 (GRCm39) N34S probably benign Het
Mroh4 T C 15: 74,497,276 (GRCm39) T182A probably benign Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Myo5a T C 9: 75,074,319 (GRCm39) F743L possibly damaging Het
Notch4 A C 17: 34,802,407 (GRCm39) D1276A probably damaging Het
Or1e34 A T 11: 73,778,843 (GRCm39) Y118* probably null Het
Or3a10 A G 11: 73,935,873 (GRCm39) C76R possibly damaging Het
Or6c209 T A 10: 129,483,218 (GRCm39) C74S probably damaging Het
Or6d15 T A 6: 116,559,617 (GRCm39) I97L probably benign Het
Plin4 T A 17: 56,413,567 (GRCm39) T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 (GRCm39) T827A probably benign Het
Prlr C T 15: 10,317,652 (GRCm39) T40I probably damaging Het
Psme3 T C 11: 101,210,730 (GRCm39) probably benign Het
Pygb A T 2: 150,657,626 (GRCm39) D363V probably benign Het
Rsph6a C T 7: 18,788,871 (GRCm39) Q68* probably null Het
Sh2d2a T C 3: 87,759,195 (GRCm39) probably benign Het
Skint7 A C 4: 111,837,395 (GRCm39) M58L probably benign Het
Slco3a1 G T 7: 73,970,301 (GRCm39) Y435* probably null Het
Stk17b T C 1: 53,801,742 (GRCm39) probably benign Het
Tinag T A 9: 76,938,992 (GRCm39) H162L possibly damaging Het
Ttc21a T A 9: 119,787,865 (GRCm39) L811Q probably damaging Het
Ttc41 A T 10: 86,594,961 (GRCm39) M912L probably benign Het
Vmn2r98 G T 17: 19,273,875 (GRCm39) V41F probably benign Het
Washc5 C T 15: 59,213,942 (GRCm39) C838Y possibly damaging Het
Wrnip1 A G 13: 32,990,796 (GRCm39) T352A probably damaging Het
Zan A C 5: 137,394,439 (GRCm39) C4467G unknown Het
Zc3h7a T C 16: 10,970,197 (GRCm39) probably benign Het
Zfp729a C A 13: 67,768,345 (GRCm39) C628F probably benign Het
Other mutations in Serpini2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Serpini2 APN 3 75,156,549 (GRCm39) missense probably damaging 1.00
IGL00736:Serpini2 APN 3 75,175,116 (GRCm39) missense possibly damaging 0.70
IGL03398:Serpini2 APN 3 75,166,852 (GRCm39) missense probably benign 0.00
R0271:Serpini2 UTSW 3 75,153,885 (GRCm39) missense probably damaging 1.00
R2309:Serpini2 UTSW 3 75,166,997 (GRCm39) missense probably damaging 0.99
R2435:Serpini2 UTSW 3 75,165,475 (GRCm39) missense probably benign 0.00
R2886:Serpini2 UTSW 3 75,166,921 (GRCm39) missense probably damaging 1.00
R5054:Serpini2 UTSW 3 75,166,784 (GRCm39) missense probably damaging 1.00
R5151:Serpini2 UTSW 3 75,153,820 (GRCm39) missense possibly damaging 0.93
R5554:Serpini2 UTSW 3 75,175,295 (GRCm39) start gained probably benign
R5614:Serpini2 UTSW 3 75,165,014 (GRCm39) intron probably benign
R6413:Serpini2 UTSW 3 75,166,921 (GRCm39) missense probably damaging 1.00
R6510:Serpini2 UTSW 3 75,159,875 (GRCm39) missense probably damaging 0.97
R6688:Serpini2 UTSW 3 75,166,870 (GRCm39) missense possibly damaging 0.88
R7178:Serpini2 UTSW 3 75,165,455 (GRCm39) missense probably damaging 1.00
R8491:Serpini2 UTSW 3 75,159,822 (GRCm39) missense probably damaging 1.00
R9586:Serpini2 UTSW 3 75,166,891 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCATGCAGCTCGGAGAACCATC -3'
(R):5'- ACCAGTGAAAACAGCTCTGTGCAAG -3'

Sequencing Primer
(F):5'- GAGCAGTAACTTGGTTTTCCAC -3'
(R):5'- TGTTCTCCACCCTCTTTATAGGA -3'
Posted On 2013-06-11