Incidental Mutation 'R5799:Chmp6'
ID447413
Institutional Source Beutler Lab
Gene Symbol Chmp6
Ensembl Gene ENSMUSG00000025371
Gene Namecharged multivesicular body protein 6
Synonyms2400004G01Rik, chromatin modifying protein 6
MMRRC Submission 043388-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5799 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location119913441-119919548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119916691 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 120 (I120T)
Ref Sequence ENSEMBL: ENSMUSP00000026434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026434] [ENSMUST00000124199] [ENSMUST00000132197] [ENSMUST00000148232]
Predicted Effect probably benign
Transcript: ENSMUST00000026434
AA Change: I120T

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026434
Gene: ENSMUSG00000025371
AA Change: I120T

DomainStartEndE-ValueType
Pfam:Snf7 18 178 2.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124199
Predicted Effect probably benign
Transcript: ENSMUST00000132197
AA Change: I34T

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114645
Gene: ENSMUSG00000025371
AA Change: I34T

DomainStartEndE-ValueType
Pfam:Snf7 1 78 5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139814
Predicted Effect probably benign
Transcript: ENSMUST00000148232
AA Change: I34T

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.8017 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 89% (51/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chromatin-modifying protein/charged multivesicular body protein family. Proteins in this family are part of the ESCRT-III (endosomal sorting complex required for transport III) which degrades surface receptors, and in biosynthesis of endosomes. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,769 E284G probably damaging Het
AA986860 C T 1: 130,741,171 Q92* probably null Het
Accsl T C 2: 93,864,403 probably null Het
Ahnak2 T C 12: 112,778,930 probably benign Het
Alcam T C 16: 52,309,849 D46G probably benign Het
Asap2 T C 12: 21,168,246 S57P probably damaging Het
Atg14 A T 14: 47,547,295 V314D possibly damaging Het
C230029F24Rik C T 1: 49,338,148 noncoding transcript Het
Calcr A T 6: 3,707,592 I236N probably benign Het
Cass4 G A 2: 172,416,187 G35E probably damaging Het
Col13a1 A G 10: 61,849,140 probably benign Het
Ddhd2 T A 8: 25,748,602 L328F probably damaging Het
Dnmt3l A G 10: 78,052,026 D123G possibly damaging Het
Eea1 T A 10: 96,002,948 V287E possibly damaging Het
Efcc1 A G 6: 87,731,182 N97S probably benign Het
Exd1 A G 2: 119,538,781 S118P probably benign Het
Ext2 G T 2: 93,811,972 T184K probably benign Het
Fam186a G A 15: 99,966,824 Q42* probably null Het
Gbp2 A T 3: 142,632,082 I320L probably benign Het
Gm15292 T A 8: 21,250,343 probably null Het
Gm5483 T A 16: 36,184,261 M1K probably null Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
H2-Q5 T C 17: 35,394,139 M5T unknown Het
Jak3 C T 8: 71,678,700 L70F probably damaging Het
Lhpp G A 7: 132,705,635 V254M probably damaging Het
Lig1 T A 7: 13,296,258 V387E possibly damaging Het
Lipo1 T C 19: 33,777,693 probably benign Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Narf T C 11: 121,244,654 Y111H probably damaging Het
Ncf4 A G 15: 78,250,977 K78R probably benign Het
Nrap A T 19: 56,342,169 C1118* probably null Het
Nubp2 A G 17: 24,885,798 V23A probably damaging Het
Olfr723 A T 14: 49,929,040 F168Y probably damaging Het
Olfr818 A T 10: 129,945,911 D50E possibly damaging Het
Olfr972 T C 9: 39,874,096 S274P possibly damaging Het
Pdzd7 G A 19: 45,036,989 P356S probably benign Het
Rttn T C 18: 89,037,946 V984A probably damaging Het
Ryr3 A G 2: 112,686,580 S3334P probably damaging Het
Senp7 G A 16: 56,139,105 probably null Het
Slc25a3 A C 10: 91,122,041 Y50D probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A T 15: 96,695,089 S163T probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stam2 A T 2: 52,720,910 C4* probably null Het
Taf1a A G 1: 183,395,934 D50G possibly damaging Het
Taf6l A T 19: 8,782,631 Y106N possibly damaging Het
Tbx20 G A 9: 24,725,520 Q424* probably null Het
Tex10 A G 4: 48,433,295 V829A possibly damaging Het
Tgfbr3 T C 5: 107,109,608 probably benign Het
Tnfsf10 G T 3: 27,335,593 V268F probably damaging Het
Trrap A G 5: 144,830,945 T2571A probably benign Het
Other mutations in Chmp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Chmp6 APN 11 119916986 missense probably benign 0.19
IGL03405:Chmp6 APN 11 119915447 missense probably damaging 1.00
R0035:Chmp6 UTSW 11 119916682 missense probably damaging 0.99
R0164:Chmp6 UTSW 11 119915523 critical splice donor site probably null
R0164:Chmp6 UTSW 11 119915523 critical splice donor site probably null
R0345:Chmp6 UTSW 11 119918046 unclassified probably benign
R1528:Chmp6 UTSW 11 119916715 missense probably benign 0.04
R2187:Chmp6 UTSW 11 119916736 missense possibly damaging 0.95
R5026:Chmp6 UTSW 11 119918643 missense probably damaging 0.98
R7059:Chmp6 UTSW 11 119916040 missense probably damaging 0.98
R7486:Chmp6 UTSW 11 119916957 missense probably benign 0.38
R7490:Chmp6 UTSW 11 119915443 nonsense probably null
R7862:Chmp6 UTSW 11 119917010 critical splice donor site probably null
R7908:Chmp6 UTSW 11 119913830 unclassified probably benign
R7945:Chmp6 UTSW 11 119917010 critical splice donor site probably null
X0025:Chmp6 UTSW 11 119916116 splice site probably null
Predicted Primers PCR Primer
(F):5'- CACCACGCAGGAAGGATTTC -3'
(R):5'- ATGGACTGTGAAGGGTATTTCCAAC -3'

Sequencing Primer
(F):5'- GACCTGGTTTACTCTCAATTGTCGG -3'
(R):5'- AAGGGTATTTCCAACTGGGCCTC -3'
Posted On2016-12-15