Incidental Mutation 'R5799:Asap2'
ID447415
Institutional Source Beutler Lab
Gene Symbol Asap2
Ensembl Gene ENSMUSG00000052632
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms6530401G17Rik, LOC385250, Ddef2
MMRRC Submission 043388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5799 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location20990459-21270171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21168246 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 57 (S57P)
Ref Sequence ENSEMBL: ENSMUSP00000063217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050990] [ENSMUST00000064595] [ENSMUST00000090834] [ENSMUST00000101562]
Predicted Effect probably damaging
Transcript: ENSMUST00000050990
AA Change: S57P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054631
Gene: ENSMUSG00000052632
AA Change: S57P

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
SH3 896 954 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064595
AA Change: S57P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632
AA Change: S57P

DomainStartEndE-ValueType
Pfam:BAR 11 247 2.4e-9 PFAM
Pfam:BAR_3 31 265 3.3e-28 PFAM
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 892 N/A INTRINSIC
SH3 941 999 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090834
AA Change: S57P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632
AA Change: S57P

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
Blast:PH 196 318 1e-50 BLAST
Blast:ArfGap 334 395 5e-30 BLAST
ANK 438 470 6.17e-1 SMART
ANK 474 503 4.03e-5 SMART
ANK 507 537 1.48e3 SMART
low complexity region 547 561 N/A INTRINSIC
low complexity region 619 643 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
SH3 750 808 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101562
AA Change: S57P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632
AA Change: S57P

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 309 402 2.31e-18 SMART
ArfGap 424 544 6.82e-27 SMART
ANK 587 619 6.17e-1 SMART
ANK 623 652 4.03e-5 SMART
ANK 656 686 1.48e3 SMART
low complexity region 696 710 N/A INTRINSIC
low complexity region 768 792 N/A INTRINSIC
low complexity region 830 850 N/A INTRINSIC
SH3 899 957 4.28e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174530
Meta Mutation Damage Score 0.4412 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 89% (51/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,769 E284G probably damaging Het
AA986860 C T 1: 130,741,171 Q92* probably null Het
Accsl T C 2: 93,864,403 probably null Het
Ahnak2 T C 12: 112,778,930 probably benign Het
Alcam T C 16: 52,309,849 D46G probably benign Het
Atg14 A T 14: 47,547,295 V314D possibly damaging Het
C230029F24Rik C T 1: 49,338,148 noncoding transcript Het
Calcr A T 6: 3,707,592 I236N probably benign Het
Cass4 G A 2: 172,416,187 G35E probably damaging Het
Chmp6 T C 11: 119,916,691 I120T probably benign Het
Col13a1 A G 10: 61,849,140 probably benign Het
Ddhd2 T A 8: 25,748,602 L328F probably damaging Het
Dnmt3l A G 10: 78,052,026 D123G possibly damaging Het
Eea1 T A 10: 96,002,948 V287E possibly damaging Het
Efcc1 A G 6: 87,731,182 N97S probably benign Het
Exd1 A G 2: 119,538,781 S118P probably benign Het
Ext2 G T 2: 93,811,972 T184K probably benign Het
Fam186a G A 15: 99,966,824 Q42* probably null Het
Gbp2 A T 3: 142,632,082 I320L probably benign Het
Gm15292 T A 8: 21,250,343 probably null Het
Gm5483 T A 16: 36,184,261 M1K probably null Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
H2-Q5 T C 17: 35,394,139 M5T unknown Het
Jak3 C T 8: 71,678,700 L70F probably damaging Het
Lhpp G A 7: 132,705,635 V254M probably damaging Het
Lig1 T A 7: 13,296,258 V387E possibly damaging Het
Lipo1 T C 19: 33,777,693 probably benign Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Narf T C 11: 121,244,654 Y111H probably damaging Het
Ncf4 A G 15: 78,250,977 K78R probably benign Het
Nrap A T 19: 56,342,169 C1118* probably null Het
Nubp2 A G 17: 24,885,798 V23A probably damaging Het
Olfr723 A T 14: 49,929,040 F168Y probably damaging Het
Olfr818 A T 10: 129,945,911 D50E possibly damaging Het
Olfr972 T C 9: 39,874,096 S274P possibly damaging Het
Pdzd7 G A 19: 45,036,989 P356S probably benign Het
Rttn T C 18: 89,037,946 V984A probably damaging Het
Ryr3 A G 2: 112,686,580 S3334P probably damaging Het
Senp7 G A 16: 56,139,105 probably null Het
Slc25a3 A C 10: 91,122,041 Y50D probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A T 15: 96,695,089 S163T probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stam2 A T 2: 52,720,910 C4* probably null Het
Taf1a A G 1: 183,395,934 D50G possibly damaging Het
Taf6l A T 19: 8,782,631 Y106N possibly damaging Het
Tbx20 G A 9: 24,725,520 Q424* probably null Het
Tex10 A G 4: 48,433,295 V829A possibly damaging Het
Tgfbr3 T C 5: 107,109,608 probably benign Het
Tnfsf10 G T 3: 27,335,593 V268F probably damaging Het
Trrap A G 5: 144,830,945 T2571A probably benign Het
Other mutations in Asap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Asap2 APN 12 21239648 missense possibly damaging 0.66
IGL01140:Asap2 APN 12 21206316 missense probably damaging 1.00
IGL01285:Asap2 APN 12 21229263 missense probably damaging 1.00
IGL01318:Asap2 APN 12 21247295 missense probably null 0.00
IGL01355:Asap2 APN 12 21218086 splice site probably benign
IGL01593:Asap2 APN 12 21213202 missense probably null 0.03
IGL01705:Asap2 APN 12 21249368 missense possibly damaging 0.85
IGL01716:Asap2 APN 12 21254306 missense possibly damaging 0.94
IGL02822:Asap2 APN 12 21265910 missense probably damaging 1.00
IGL02876:Asap2 APN 12 21258163 missense probably benign 0.00
IGL02991:Asap2 APN 12 21249293 splice site probably benign
R0157:Asap2 UTSW 12 21206325 missense probably damaging 1.00
R0399:Asap2 UTSW 12 21217997 missense possibly damaging 0.90
R0472:Asap2 UTSW 12 21213185 missense possibly damaging 0.47
R0959:Asap2 UTSW 12 21247319 missense probably damaging 1.00
R0981:Asap2 UTSW 12 21265960 missense probably damaging 0.98
R1141:Asap2 UTSW 12 21185110 missense probably damaging 1.00
R1382:Asap2 UTSW 12 21265954 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239585 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239589 missense probably damaging 1.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1526:Asap2 UTSW 12 21185187 missense probably damaging 1.00
R1542:Asap2 UTSW 12 21265997 missense probably damaging 1.00
R1710:Asap2 UTSW 12 21224392 missense probably damaging 1.00
R1750:Asap2 UTSW 12 21203998 missense probably damaging 1.00
R2151:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2152:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2154:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2323:Asap2 UTSW 12 21203968 missense probably damaging 1.00
R2378:Asap2 UTSW 12 21254318 missense possibly damaging 0.95
R3151:Asap2 UTSW 12 21224377 missense probably damaging 1.00
R3757:Asap2 UTSW 12 21267766 missense probably damaging 1.00
R4305:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4307:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4308:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4345:Asap2 UTSW 12 21230831 missense probably damaging 1.00
R4525:Asap2 UTSW 12 21229292 splice site probably null
R4562:Asap2 UTSW 12 21112093 missense probably damaging 1.00
R4999:Asap2 UTSW 12 21252765 missense probably benign 0.19
R5027:Asap2 UTSW 12 21204081 missense probably damaging 1.00
R5221:Asap2 UTSW 12 21213190 missense probably benign 0.14
R5645:Asap2 UTSW 12 21265982 missense probably damaging 0.99
R5876:Asap2 UTSW 12 21212809 missense possibly damaging 0.88
R5888:Asap2 UTSW 12 21218190 missense probably damaging 1.00
R5912:Asap2 UTSW 12 21206343 missense probably damaging 1.00
R6576:Asap2 UTSW 12 21244703 missense probably damaging 1.00
R6896:Asap2 UTSW 12 21265525 missense probably damaging 1.00
R6934:Asap2 UTSW 12 21168250 missense probably damaging 1.00
R7134:Asap2 UTSW 12 21265963 nonsense probably null
R7347:Asap2 UTSW 12 21229457 missense probably benign 0.03
R7515:Asap2 UTSW 12 21229239 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ATTGAACTGCTACTCTGTGTGC -3'
(R):5'- GAACTGTTCCTGAGCCAGAC -3'

Sequencing Primer
(F):5'- CTACTCTGTGTGCTTTGAAAGAC -3'
(R):5'- TGTTCCTGAGCCAGACTACAG -3'
Posted On2016-12-15