Incidental Mutation 'R5799:Taf6l'
ID447431
Institutional Source Beutler Lab
Gene Symbol Taf6l
Ensembl Gene ENSMUSG00000003680
Gene NameTATA-box binding protein associated factor 6 like
SynonymsPAF65A, 2810417N14Rik, C530024J06Rik
MMRRC Submission 043388-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5799 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8772522-8786417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8782631 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 106 (Y106N)
Ref Sequence ENSEMBL: ENSMUSP00000140136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003777] [ENSMUST00000176496] [ENSMUST00000176610] [ENSMUST00000177056] [ENSMUST00000177216] [ENSMUST00000189739]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003777
AA Change: Y106N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003777
Gene: ENSMUSG00000003680
AA Change: Y106N

DomainStartEndE-ValueType
TAF 16 79 9.03e-28 SMART
Pfam:DUF1546 248 339 4.5e-29 PFAM
low complexity region 565 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176331
Predicted Effect possibly damaging
Transcript: ENSMUST00000176496
AA Change: Y107N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135090
Gene: ENSMUSG00000003680
AA Change: Y107N

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 224 315 4.3e-29 PFAM
low complexity region 541 552 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176610
AA Change: Y107N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135193
Gene: ENSMUSG00000003680
AA Change: Y107N

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:TAF6_C 249 338 6.6e-22 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176991
Predicted Effect possibly damaging
Transcript: ENSMUST00000177056
AA Change: Y100N

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135028
Gene: ENSMUSG00000003680
AA Change: Y100N

DomainStartEndE-ValueType
TAF 10 73 9.03e-28 SMART
Pfam:DUF1546 242 333 4.5e-29 PFAM
low complexity region 559 570 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177216
AA Change: Y107N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135220
Gene: ENSMUSG00000003680
AA Change: Y107N

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 249 340 6.4e-29 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189739
AA Change: Y106N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140136
Gene: ENSMUSG00000003680
AA Change: Y106N

DomainStartEndE-ValueType
TAF 16 79 3.8e-31 SMART
Pfam:DUF1546 223 314 6.3e-26 PFAM
low complexity region 540 551 N/A INTRINSIC
Meta Mutation Damage Score 0.5557 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 89% (51/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a protein that is a component of the PCAF histone acetylase complex and structurally similar to one of the histone-like TAFs, TAF6. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,769 E284G probably damaging Het
AA986860 C T 1: 130,741,171 Q92* probably null Het
Accsl T C 2: 93,864,403 probably null Het
Ahnak2 T C 12: 112,778,930 probably benign Het
Alcam T C 16: 52,309,849 D46G probably benign Het
Asap2 T C 12: 21,168,246 S57P probably damaging Het
Atg14 A T 14: 47,547,295 V314D possibly damaging Het
C230029F24Rik C T 1: 49,338,148 noncoding transcript Het
Calcr A T 6: 3,707,592 I236N probably benign Het
Cass4 G A 2: 172,416,187 G35E probably damaging Het
Chmp6 T C 11: 119,916,691 I120T probably benign Het
Col13a1 A G 10: 61,849,140 probably benign Het
Ddhd2 T A 8: 25,748,602 L328F probably damaging Het
Dnmt3l A G 10: 78,052,026 D123G possibly damaging Het
Eea1 T A 10: 96,002,948 V287E possibly damaging Het
Efcc1 A G 6: 87,731,182 N97S probably benign Het
Exd1 A G 2: 119,538,781 S118P probably benign Het
Ext2 G T 2: 93,811,972 T184K probably benign Het
Fam186a G A 15: 99,966,824 Q42* probably null Het
Gbp2 A T 3: 142,632,082 I320L probably benign Het
Gm15292 T A 8: 21,250,343 probably null Het
Gm5483 T A 16: 36,184,261 M1K probably null Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
H2-Q5 T C 17: 35,394,139 M5T unknown Het
Jak3 C T 8: 71,678,700 L70F probably damaging Het
Lhpp G A 7: 132,705,635 V254M probably damaging Het
Lig1 T A 7: 13,296,258 V387E possibly damaging Het
Lipo1 T C 19: 33,777,693 probably benign Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Narf T C 11: 121,244,654 Y111H probably damaging Het
Ncf4 A G 15: 78,250,977 K78R probably benign Het
Nrap A T 19: 56,342,169 C1118* probably null Het
Nubp2 A G 17: 24,885,798 V23A probably damaging Het
Olfr723 A T 14: 49,929,040 F168Y probably damaging Het
Olfr818 A T 10: 129,945,911 D50E possibly damaging Het
Olfr972 T C 9: 39,874,096 S274P possibly damaging Het
Pdzd7 G A 19: 45,036,989 P356S probably benign Het
Rttn T C 18: 89,037,946 V984A probably damaging Het
Ryr3 A G 2: 112,686,580 S3334P probably damaging Het
Senp7 G A 16: 56,139,105 probably null Het
Slc25a3 A C 10: 91,122,041 Y50D probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A T 15: 96,695,089 S163T probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stam2 A T 2: 52,720,910 C4* probably null Het
Taf1a A G 1: 183,395,934 D50G possibly damaging Het
Tbx20 G A 9: 24,725,520 Q424* probably null Het
Tex10 A G 4: 48,433,295 V829A possibly damaging Het
Tgfbr3 T C 5: 107,109,608 probably benign Het
Tnfsf10 G T 3: 27,335,593 V268F probably damaging Het
Trrap A G 5: 144,830,945 T2571A probably benign Het
Other mutations in Taf6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Taf6l APN 19 8783388 missense probably benign 0.04
IGL00781:Taf6l APN 19 8773661 missense probably damaging 1.00
IGL01886:Taf6l APN 19 8778086 critical splice donor site probably null
IGL02638:Taf6l APN 19 8775266 missense probably benign 0.03
IGL02676:Taf6l APN 19 8775049 missense probably damaging 1.00
R0096:Taf6l UTSW 19 8778517 missense probably benign 0.06
R0110:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0469:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0510:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0676:Taf6l UTSW 19 8773369 missense probably benign 0.00
R0711:Taf6l UTSW 19 8778517 missense probably benign 0.06
R1804:Taf6l UTSW 19 8773634 missense probably damaging 0.99
R1971:Taf6l UTSW 19 8775502 unclassified probably null
R2869:Taf6l UTSW 19 8778628 unclassified probably benign
R2870:Taf6l UTSW 19 8778628 unclassified probably benign
R3105:Taf6l UTSW 19 8778855 missense probably damaging 1.00
R4578:Taf6l UTSW 19 8783971 missense possibly damaging 0.95
R4581:Taf6l UTSW 19 8778208 missense probably damaging 0.99
R4841:Taf6l UTSW 19 8782406 missense possibly damaging 0.77
R4842:Taf6l UTSW 19 8782406 missense possibly damaging 0.77
R5215:Taf6l UTSW 19 8778053 intron probably benign
R5269:Taf6l UTSW 19 8774962 missense probably damaging 1.00
R5571:Taf6l UTSW 19 8783930 missense probably damaging 1.00
R5687:Taf6l UTSW 19 8773312 missense probably benign 0.01
R5814:Taf6l UTSW 19 8774846 missense probably benign 0.13
R6008:Taf6l UTSW 19 8778166 missense possibly damaging 0.65
R6091:Taf6l UTSW 19 8778556 missense probably benign 0.04
R6228:Taf6l UTSW 19 8778666 missense probably benign 0.01
R6569:Taf6l UTSW 19 8772710 missense probably damaging 1.00
R6768:Taf6l UTSW 19 8774549 missense probably damaging 1.00
R7586:Taf6l UTSW 19 8783846 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGCCCTACGTGAAAGCTG -3'
(R):5'- TTGACCCAGTGAACCACAG -3'

Sequencing Primer
(F):5'- TACGTGAAAGCTGGCCCATCAG -3'
(R):5'- CTAGGGGATATGTGAACTACTCTGC -3'
Posted On2016-12-15