Incidental Mutation 'R5810:Sp100'
ID447439
Institutional Source Beutler Lab
Gene Symbol Sp100
Ensembl Gene ENSMUSG00000026222
Gene Namenuclear antigen Sp100
Synonyms
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location85649988-85709998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85665285 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 145 (G145D)
Ref Sequence ENSEMBL: ENSMUSP00000066399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054279] [ENSMUST00000066427] [ENSMUST00000145440] [ENSMUST00000147552] [ENSMUST00000150967] [ENSMUST00000153574] [ENSMUST00000155094]
Predicted Effect probably benign
Transcript: ENSMUST00000054279
AA Change: G145D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051705
Gene: ENSMUSG00000026222
AA Change: G145D

DomainStartEndE-ValueType
Pfam:Sp100 19 122 4.9e-47 PFAM
low complexity region 334 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066427
AA Change: G145D

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000066399
Gene: ENSMUSG00000026222
AA Change: G145D

DomainStartEndE-ValueType
Pfam:Sp100 21 119 3.4e-40 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
BROMO 473 573 1.16e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141998
Predicted Effect probably benign
Transcript: ENSMUST00000145440
AA Change: G145D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120604
Gene: ENSMUSG00000026222
AA Change: G145D

DomainStartEndE-ValueType
Pfam:Sp100 19 122 3.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147552
AA Change: G145D

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116942
Gene: ENSMUSG00000026222
AA Change: G145D

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.5e-46 PFAM
low complexity region 305 319 N/A INTRINSIC
low complexity region 349 359 N/A INTRINSIC
SAND 368 441 8.85e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150967
AA Change: G145D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122899
Gene: ENSMUSG00000026222
AA Change: G145D

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.1e-46 PFAM
low complexity region 324 334 N/A INTRINSIC
SAND 343 416 8.85e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153574
AA Change: G145D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122670
Gene: ENSMUSG00000026222
AA Change: G145D

DomainStartEndE-ValueType
Pfam:Sp100 19 122 9.2e-47 PFAM
low complexity region 342 352 N/A INTRINSIC
SAND 361 434 8.85e-38 SMART
Blast:BROMO 453 476 9e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155094
AA Change: G145D

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118481
Gene: ENSMUSG00000026222
AA Change: G145D

DomainStartEndE-ValueType
Pfam:Sp100 19 122 1.6e-46 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
Meta Mutation Damage Score 0.0955 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Sp100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Sp100 APN 1 85670020 missense possibly damaging 0.48
IGL01998:Sp100 APN 1 85666929 missense probably benign 0.01
IGL02192:Sp100 APN 1 85708001 missense probably damaging 0.99
IGL02809:Sp100 APN 1 85681124 missense probably damaging 0.99
IGL03274:Sp100 APN 1 85707304 intron probably benign
PIT4458001:Sp100 UTSW 1 85708116 missense probably benign 0.10
R0115:Sp100 UTSW 1 85650131 splice site probably benign
R0599:Sp100 UTSW 1 85681110 missense possibly damaging 0.68
R0620:Sp100 UTSW 1 85659867 splice site probably null
R0693:Sp100 UTSW 1 85667005 critical splice donor site probably null
R0709:Sp100 UTSW 1 85694281 missense probably damaging 0.96
R0744:Sp100 UTSW 1 85699744 missense probably damaging 0.97
R0836:Sp100 UTSW 1 85699744 missense probably damaging 0.97
R1175:Sp100 UTSW 1 85701420 missense possibly damaging 0.83
R1496:Sp100 UTSW 1 85663521 splice site probably benign
R1749:Sp100 UTSW 1 85699636 missense possibly damaging 0.95
R2046:Sp100 UTSW 1 85709065 missense possibly damaging 0.53
R2069:Sp100 UTSW 1 85681142 splice site probably null
R2441:Sp100 UTSW 1 85703489 unclassified probably benign
R3933:Sp100 UTSW 1 85681109 missense probably benign 0.29
R4171:Sp100 UTSW 1 85706841 missense probably benign 0.00
R4762:Sp100 UTSW 1 85701458 makesense probably null
R4863:Sp100 UTSW 1 85705003 missense probably benign 0.03
R5156:Sp100 UTSW 1 85673683 missense probably damaging 1.00
R5273:Sp100 UTSW 1 85709104 missense possibly damaging 0.86
R5635:Sp100 UTSW 1 85682264 intron probably benign
R5910:Sp100 UTSW 1 85681140 critical splice donor site probably null
R5931:Sp100 UTSW 1 85679083 missense probably damaging 1.00
R7466:Sp100 UTSW 1 85707239 missense possibly damaging 0.93
R7514:Sp100 UTSW 1 85681139 nonsense probably null
R7647:Sp100 UTSW 1 85692043 missense possibly damaging 0.91
R7851:Sp100 UTSW 1 85706926 missense probably benign 0.12
R7908:Sp100 UTSW 1 85708067 missense possibly damaging 0.51
R8064:Sp100 UTSW 1 85681139 nonsense probably null
R8094:Sp100 UTSW 1 85697098 missense possibly damaging 0.95
R8757:Sp100 UTSW 1 85662564 missense possibly damaging 0.92
R8785:Sp100 UTSW 1 85699751 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TCCATGACCTGAGTCTGACC -3'
(R):5'- GCTCACAGTGTATGGGTGAC -3'

Sequencing Primer
(F):5'- TGACCTGAGTCTGACCTCAAG -3'
(R):5'- ATCACCCCGTGTAGGTAGTCCTAAG -3'
Posted On2016-12-15