Mutagenetix > Incidental Mutations

Incidental Mutation 'R5810:Ninl'

447444

Institutional Source

Beutler Lab

Gene Symbol

Ninl

Ensembl Gene

ENSMUSG00000068115

Gene Name

ninein-like

Synonyms

LOC381387, LOC381388, 4930519N13Rik

MMRRC Submission

043395-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5810 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

150934519-151039382 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 150950168 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 812 (R812G)

Ref Sequence

ENSEMBL: ENSMUSP00000105522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109896] [ENSMUST00000124135]

Predicted Effect

probably benign
Transcript: ENSMUST00000109896
AA Change: R812G

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000105522
Gene: ENSMUSG00000068115
AA Change: R812G

Domain	Start	End	E-Value	Type
EFh	12	40	6.56e0	SMART
low complexity region	76	93	N/A	INTRINSIC
EFh	201	229	4.45e1	SMART
EFh	238	266	8.98e-4	SMART
low complexity region	295	306	N/A	INTRINSIC
coiled coil region	381	423	N/A	INTRINSIC
coiled coil region	461	517	N/A	INTRINSIC
coiled coil region	541	584	N/A	INTRINSIC
coiled coil region	620	699	N/A	INTRINSIC
coiled coil region	728	751	N/A	INTRINSIC
coiled coil region	835	863	N/A	INTRINSIC
coiled coil region	1058	1334	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000117833

Predicted Effect

probably benign
Transcript: ENSMUST00000124135

SMART Domains

Protein: ENSMUSP00000122069
Gene: ENSMUSG00000068115

Domain	Start	End	E-Value	Type
coiled coil region	16	61	N/A	INTRINSIC
coiled coil region	92	266	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147293

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

100% (66/66)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit bone-marrow myeloid hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,079,631	F866L	probably benign	Het
Abca16	T	A	7: 120,435,932	C314S	probably damaging	Het
Actl11	C	T	9: 107,929,221	P248S	probably benign	Het
Actr3	A	G	1: 125,416,379		probably benign	Het
Baz1a	G	A	12: 54,927,715		probably benign	Het
Birc6	A	C	17: 74,670,374	N4388T	probably damaging	Het
Bpifa5	G	A	2: 154,163,718		probably null	Het
Car13	A	C	3: 14,641,768		probably null	Het
Ceacam18	A	T	7: 43,636,958	H85L	probably benign	Het
Cnnm3	A	G	1: 36,525,199	E704G	probably benign	Het
Cyp4f14	T	A	17: 32,906,098	I450F	possibly damaging	Het
Ddhd1	G	T	14: 45,602,707	T710N	probably damaging	Het
Ddx60	C	T	8: 62,012,388	Q1360*	probably null	Het
Dlg5	A	G	14: 24,146,254	V1625A	probably damaging	Het
Dst	G	A	1: 34,183,040		probably benign	Het
Dyrk2	G	T	10: 118,860,340	H338N	probably benign	Het
Epb41l1	A	T	2: 156,499,655	I187F	probably damaging	Het
Esd	A	G	14: 74,745,611	D221G	probably damaging	Het
Fam53b	T	A	7: 132,760,164	N45I	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fryl	A	T	5: 73,090,755	D1006E	probably benign	Het
Gli3	T	C	13: 15,644,309	V232A	probably damaging	Het
Gm12666	A	T	4: 92,191,583		probably null	Het
Gm28308	C	A	6: 52,213,216		probably benign	Het
Gpatch1	G	A	7: 35,295,371	A490V	probably benign	Het
Hoxa7	T	C	6: 52,216,024	D128G	probably benign	Het
Igdcc4	A	G	9: 65,128,695	T751A	probably damaging	Het
Igsf10	G	A	3: 59,319,071	L2394F	probably damaging	Het
Il15ra	A	G	2: 11,733,252		probably null	Het
Il17re	C	T	6: 113,469,596	A436V	probably damaging	Het
Krtap19-2	T	C	16: 88,874,236		probably benign	Het
Lgals12	T	C	19: 7,606,720	D4G	probably benign	Het
Liph	A	T	16: 21,968,110	L252Q	probably damaging	Het
Mtg1	T	A	7: 140,145,985		probably null	Het
Myo18b	A	G	5: 112,834,450	L1139P	probably damaging	Het
Npm3	A	G	19: 45,748,205	I165T	possibly damaging	Het
Olfr381	G	T	11: 73,486,095	S243*	probably null	Het
Osbpl9	A	G	4: 109,086,374	V231A	probably benign	Het
Pgam2	T	C	11: 5,803,417	H91R	possibly damaging	Het
Pkhd1	A	G	1: 20,200,673	W3219R	probably benign	Het
Procr	A	G	2: 155,751,407	K4E	possibly damaging	Het
Slc22a16	C	T	10: 40,595,318	T495I	possibly damaging	Het
Slc22a6	A	G	19: 8,623,858	K425E	probably damaging	Het
Slco6c1	A	T	1: 97,075,873	C500S	probably damaging	Het
Snrpd2	G	T	7: 19,152,522	V77F	probably benign	Het
Sp100	G	A	1: 85,665,285	G145D	probably benign	Het
Spg7	G	A	8: 123,094,569	E678K	possibly damaging	Het
Ssh1	T	C	5: 113,946,566	K538E	probably benign	Het
Sspo	C	T	6: 48,483,898	R3356W	probably benign	Het
Stx1a	G	T	5: 135,049,078	V255F	probably damaging	Het
Tbc1d13	C	A	2: 30,142,368	Q164K	probably benign	Het
Tfpi	AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA	AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA	2: 84,434,424		probably benign	Het
Tpm2	T	C	4: 43,518,968		probably benign	Het
Triobp	T	C	15: 78,968,267	C874R	probably benign	Het
Tymp	T	A	15: 89,374,331	H269L	probably damaging	Het
Vmn1r194	T	A	13: 22,244,427	Y71*	probably null	Het
Vmn2r102	T	C	17: 19,677,542	V273A	probably benign	Het
Vmn2r2	A	T	3: 64,117,394	C589S	probably damaging	Het
Vps13a	T	C	19: 16,666,324	T2063A	probably benign	Het
Ywhaz	T	C	15: 36,775,266	I217M	probably damaging	Het
Zfp322a	A	C	13: 23,357,409	Y54*	probably null	Het
Zswim9	A	T	7: 13,260,735	V498D	probably damaging	Het

Other mutations in Ninl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Ninl	APN	2	150966241	missense	probably damaging	0.98
IGL01697:Ninl	APN	2	150939947	missense	probably damaging	1.00
IGL01756:Ninl	APN	2	150979516	missense	probably damaging	1.00
IGL01925:Ninl	APN	2	150971059	missense	probably damaging	1.00
IGL02341:Ninl	APN	2	150944605	nonsense	probably null
IGL02838:Ninl	APN	2	150955711	splice site	probably null
IGL02868:Ninl	APN	2	150937054	missense	probably benign
IGL03116:Ninl	APN	2	150964219	missense	probably damaging	1.00
IGL03396:Ninl	APN	2	150966212	missense	possibly damaging	0.88
R0117:Ninl	UTSW	2	150937673	missense	probably damaging	0.98
R0685:Ninl	UTSW	2	150939855	missense	possibly damaging	0.73
R0928:Ninl	UTSW	2	150963475	missense	probably damaging	0.99
R1051:Ninl	UTSW	2	150970126	missense	probably damaging	1.00
R1441:Ninl	UTSW	2	150971124	missense	probably benign	0.10
R1493:Ninl	UTSW	2	150980095	missense	probably damaging	1.00
R1499:Ninl	UTSW	2	150980176	missense	possibly damaging	0.70
R1539:Ninl	UTSW	2	150975947	missense	probably damaging	1.00
R1658:Ninl	UTSW	2	150964159	missense	probably damaging	1.00
R2038:Ninl	UTSW	2	150975843	nonsense	probably null
R2156:Ninl	UTSW	2	150944583	missense	probably damaging	1.00
R2232:Ninl	UTSW	2	150950050	missense	probably benign	0.00
R2373:Ninl	UTSW	2	150980117	missense	probably damaging	1.00
R3743:Ninl	UTSW	2	150950248	missense	probably benign	0.01
R3906:Ninl	UTSW	2	150980119	missense	probably damaging	1.00
R3950:Ninl	UTSW	2	150952488	missense	possibly damaging	0.90
R4283:Ninl	UTSW	2	150953416	unclassified	probably benign
R4798:Ninl	UTSW	2	150959881	nonsense	probably null
R4963:Ninl	UTSW	2	150939909	missense	probably benign	0.04
R4998:Ninl	UTSW	2	150953364	missense	probably damaging	1.00
R5343:Ninl	UTSW	2	150971190	missense	probably benign	0.01
R5825:Ninl	UTSW	2	150940724	missense	probably damaging	1.00
R6436:Ninl	UTSW	2	150966178	missense	probably damaging	1.00
R6728:Ninl	UTSW	2	150975857	nonsense	probably null
R6734:Ninl	UTSW	2	150945083	critical splice donor site	probably null
R6997:Ninl	UTSW	2	150966225	missense	probably benign	0.08
R7135:Ninl	UTSW	2	150955604	missense	probably benign	0.00
R7157:Ninl	UTSW	2	150949343	missense	possibly damaging	0.63
R7315:Ninl	UTSW	2	150950050	missense	probably benign	0.00
R7840:Ninl	UTSW	2	150966096	missense	probably benign	0.00
R8134:Ninl	UTSW	2	150950314	missense	probably benign	0.01
R8319:Ninl	UTSW	2	150959907	missense	probably damaging	1.00
R8802:Ninl	UTSW	2	150935252	missense	probably damaging	1.00
X0062:Ninl	UTSW	2	150970046	missense	probably damaging	1.00
Z1177:Ninl	UTSW	2	150953398	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACAGTGGTTCCATTCTTCAG -3'
(R):5'- CAAAGCGTACACCTGTGTTTCTG -3'

Sequencing Primer
(F):5'- GGTTCCATTCTTCAGGAGAGCAC -3'
(R):5'- AGCTGTCATGGCTAGAAGCTC -3'

Posted On

2016-12-15