Incidental Mutation 'R5810:Procr'
ID447446
Institutional Source Beutler Lab
Gene Symbol Procr
Ensembl Gene ENSMUSG00000027611
Gene Nameprotein C receptor, endothelial
SynonymsCcca, EPCR
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155751117-155755471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155751407 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 4 (K4E)
Ref Sequence ENSEMBL: ENSMUSP00000029140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029140] [ENSMUST00000132608]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029140
AA Change: K4E

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029140
Gene: ENSMUSG00000027611
AA Change: K4E

DomainStartEndE-ValueType
Pfam:MHC_I_3 1 201 1.4e-24 PFAM
transmembrane domain 212 234 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132608
AA Change: K4E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114567
Gene: ENSMUSG00000027611
AA Change: K4E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:3JTC|B 21 138 2e-36 PDB
SCOP:d1lqva_ 23 122 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155095
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for activated protein C, a serine protease activated by and involved in the blood coagulation pathway. The encoded protein is an N-glycosylated type I membrane protein that enhances the activation of protein C. Mutations in this gene have been associated with venous thromboembolism and myocardial infarction, as well as with late fetal loss during pregnancy. The encoded protein may also play a role in malarial infection and has been associated with cancer. [provided by RefSeq, Jul 2013]
PHENOTYPE: Nullizygous embryos die by E10.5 showing placental thrombosis, small size, and incomplete turning. Mice with a severe deficiency survive and reproduce normally. Homozygotes for the R84A variant show increased thrombin formation after thrombotic and LPS challenge, splenomegaly, and bone marrow failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Procr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02490:Procr APN 2 155753432 missense probably damaging 0.98
R4704:Procr UTSW 2 155754338 missense probably damaging 0.98
R4753:Procr UTSW 2 155753464 missense probably damaging 0.99
X0022:Procr UTSW 2 155754811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTAGTAGGAAATGAGACAG -3'
(R):5'- GTCTTTGAAACAGGAACCAAAGC -3'

Sequencing Primer
(F):5'- GATCCAAGTAACACTTTAAAAGCCTG -3'
(R):5'- CCAGGACCCAGCAGCTGTAG -3'
Posted On2016-12-15