Incidental Mutation 'R5810:Epb41l1'
ID447447
Institutional Source Beutler Lab
Gene Symbol Epb41l1
Ensembl Gene ENSMUSG00000027624
Gene Nameerythrocyte membrane protein band 4.1 like 1
SynonymsEpb4.1l1, 4.1N
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156420909-156543214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156499655 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 187 (I187F)
Ref Sequence ENSEMBL: ENSMUSP00000105202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029155] [ENSMUST00000103135] [ENSMUST00000103136] [ENSMUST00000103137] [ENSMUST00000109572] [ENSMUST00000109574] [ENSMUST00000109577] [ENSMUST00000125153]
Predicted Effect probably damaging
Transcript: ENSMUST00000029155
AA Change: I187F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029155
Gene: ENSMUSG00000027624
AA Change: I187F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103135
AA Change: I187F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099424
Gene: ENSMUSG00000027624
AA Change: I187F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103136
AA Change: I187F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099425
Gene: ENSMUSG00000027624
AA Change: I187F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103137
AA Change: I187F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099426
Gene: ENSMUSG00000027624
AA Change: I187F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109572
AA Change: I187F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105200
Gene: ENSMUSG00000027624
AA Change: I187F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 215 5.6e-12 SMART
FERM_C 219 309 1.2e-43 SMART
FA 311 357 9e-22 SMART
low complexity region 386 399 N/A INTRINSIC
Pfam:SAB 408 459 2.2e-21 PFAM
Pfam:4_1_CTD 514 619 1.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109574
AA Change: I187F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105202
Gene: ENSMUSG00000027624
AA Change: I187F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 480 531 4.8e-24 PFAM
Pfam:4_1_CTD 610 718 4.9e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109577
AA Change: I187F

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105205
Gene: ENSMUSG00000027624
AA Change: I187F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 481 532 5.9e-24 PFAM
low complexity region 594 603 N/A INTRINSIC
Pfam:4_1_CTD 758 855 5.8e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125153
AA Change: I187F

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121161
Gene: ENSMUSG00000027624
AA Change: I187F

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 492 543 7.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142048
Meta Mutation Damage Score 0.4069 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Erythrocyte membrane protein band 4.1 (EPB41) is a multifunctional protein that mediates interactions between the erythrocyte cytoskeleton and the overlying plasma membrane. The encoded protein binds and stabilizes D2 and D3 dopamine receptors at the neuronal plasma membrane. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Epb41l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Epb41l1 APN 2 156525019 missense probably damaging 1.00
IGL00852:Epb41l1 APN 2 156503718 missense probably damaging 1.00
IGL02148:Epb41l1 APN 2 156511828 intron probably benign
IGL02164:Epb41l1 APN 2 156494949 splice site probably benign
IGL02515:Epb41l1 APN 2 156537013 missense probably damaging 1.00
R0787:Epb41l1 UTSW 2 156494090 missense probably damaging 0.98
R1450:Epb41l1 UTSW 2 156511825 intron probably benign
R1566:Epb41l1 UTSW 2 156521959 missense probably benign 0.06
R1759:Epb41l1 UTSW 2 156521974 missense probably benign 0.06
R1812:Epb41l1 UTSW 2 156496511 missense probably damaging 1.00
R1908:Epb41l1 UTSW 2 156510817 missense possibly damaging 0.80
R2152:Epb41l1 UTSW 2 156514128 missense probably damaging 1.00
R3023:Epb41l1 UTSW 2 156514209 missense probably damaging 0.99
R4178:Epb41l1 UTSW 2 156521557 missense probably benign
R4491:Epb41l1 UTSW 2 156522168 missense probably benign 0.00
R4610:Epb41l1 UTSW 2 156509261 missense possibly damaging 0.71
R4770:Epb41l1 UTSW 2 156529424 missense probably benign 0.00
R5038:Epb41l1 UTSW 2 156521410 missense probably benign 0.12
R5049:Epb41l1 UTSW 2 156524939 missense possibly damaging 0.95
R5129:Epb41l1 UTSW 2 156509281 missense possibly damaging 0.80
R5624:Epb41l1 UTSW 2 156533771 splice site probably benign
R5780:Epb41l1 UTSW 2 156496525 missense probably damaging 1.00
R5952:Epb41l1 UTSW 2 156503788 missense probably damaging 1.00
R5952:Epb41l1 UTSW 2 156524983 missense probably benign
R5961:Epb41l1 UTSW 2 156521786 missense probably benign 0.25
R6118:Epb41l1 UTSW 2 156522477 missense probably benign 0.13
R6496:Epb41l1 UTSW 2 156533796 missense possibly damaging 0.92
R6861:Epb41l1 UTSW 2 156525222 missense probably benign
R6959:Epb41l1 UTSW 2 156499587 missense probably benign 0.03
R7009:Epb41l1 UTSW 2 156534683 splice site probably null
R7036:Epb41l1 UTSW 2 156529402 missense probably benign
R7046:Epb41l1 UTSW 2 156526892 missense possibly damaging 0.56
R7263:Epb41l1 UTSW 2 156495123 critical splice donor site probably null
R7322:Epb41l1 UTSW 2 156503851 missense probably damaging 0.98
R7398:Epb41l1 UTSW 2 156534762 missense probably damaging 1.00
R7914:Epb41l1 UTSW 2 156522208 missense probably benign 0.03
R8039:Epb41l1 UTSW 2 156506412 missense probably damaging 0.99
R8357:Epb41l1 UTSW 2 156525251 missense probably benign 0.16
R8415:Epb41l1 UTSW 2 156526953 missense probably benign 0.00
R8457:Epb41l1 UTSW 2 156525251 missense probably benign 0.16
R8458:Epb41l1 UTSW 2 156521764 missense probably benign 0.00
R8475:Epb41l1 UTSW 2 156522230 missense probably damaging 0.98
R8790:Epb41l1 UTSW 2 156503802 missense possibly damaging 0.62
X0065:Epb41l1 UTSW 2 156509277 missense probably damaging 1.00
Z1177:Epb41l1 UTSW 2 156508827 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATTAACGCAGCATGCACGC -3'
(R):5'- CGGCATTTAGATACATCTGTCCTTC -3'

Sequencing Primer
(F):5'- TGAACTCAGGTCATCAAGCCTGG -3'
(R):5'- AGATACATCTGTCCTTCTAAAGGCAC -3'
Posted On2016-12-15