Incidental Mutation 'R5810:Tpm2'
ID447452
Institutional Source Beutler Lab
Gene Symbol Tpm2
Ensembl Gene ENSMUSG00000028464
Gene Nametropomyosin 2, beta
SynonymsTrop-2, Tpm-2
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.616) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43514711-43523765 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 43518968 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030184] [ENSMUST00000107913] [ENSMUST00000107914] [ENSMUST00000150592]
Predicted Effect probably benign
Transcript: ENSMUST00000030184
SMART Domains Protein: ENSMUSP00000030184
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 3.3e-39 PFAM
Pfam:Tropomyosin 48 284 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107913
SMART Domains Protein: ENSMUSP00000103546
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.5e-36 PFAM
Pfam:Tropomyosin 48 284 4.8e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107914
SMART Domains Protein: ENSMUSP00000103547
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150262
Predicted Effect probably benign
Transcript: ENSMUST00000150592
SMART Domains Protein: ENSMUSP00000119908
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 106 2.2e-26 PFAM
Pfam:Tropomyosin 48 106 1.1e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene belongs to the tropomyosin family which encodes proteins that bind to actin filaments and stabilize them by regulating access to actin modifying proteins. The encoded protein is a high molecular weight tropomyosin expressed in slow skeletal muscle. In humans, mutations in this gene are associated with nemaline myopathy, cap disease and distal arthrogryposis syndromes. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Tpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Tpm2 APN 4 43518251 missense probably damaging 1.00
IGL01447:Tpm2 APN 4 43518251 nonsense probably null
IGL03145:Tpm2 APN 4 43519447 missense probably damaging 0.97
PIT4791001:Tpm2 UTSW 4 43519263 missense probably benign 0.30
R0970:Tpm2 UTSW 4 43515968 missense probably benign 0.02
R2427:Tpm2 UTSW 4 43523306 missense probably damaging 1.00
R4835:Tpm2 UTSW 4 43519220 splice site probably null
R5249:Tpm2 UTSW 4 43514828 missense probably benign
R5519:Tpm2 UTSW 4 43522751 missense possibly damaging 0.87
R5568:Tpm2 UTSW 4 43522692 nonsense probably null
R5746:Tpm2 UTSW 4 43519731 missense possibly damaging 0.90
R5850:Tpm2 UTSW 4 43523296 missense probably damaging 1.00
R6000:Tpm2 UTSW 4 43518301 critical splice acceptor site probably null
R6820:Tpm2 UTSW 4 43518443 missense probably damaging 1.00
R7909:Tpm2 UTSW 4 43515939 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGTCCCCACATTTACTGCAG -3'
(R):5'- AAACGGTAGAACTCGGCCTG -3'

Sequencing Primer
(F):5'- ACATTTACTGCAGGGGCG -3'
(R):5'- CACAGGGGTCAGGTAGTTTCC -3'
Posted On2016-12-15