Incidental Mutation 'R5810:Stx1a'
ID447459
Institutional Source Beutler Lab
Gene Symbol Stx1a
Ensembl Gene ENSMUSG00000007207
Gene Namesyntaxin 1A (brain)
SynonymsHPC-1
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135023482-135051100 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 135049078 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 255 (V255F)
Ref Sequence ENSEMBL: ENSMUSP00000005509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005509] [ENSMUST00000071677] [ENSMUST00000085984] [ENSMUST00000111205] [ENSMUST00000129691] [ENSMUST00000150838] [ENSMUST00000201008]
Predicted Effect probably damaging
Transcript: ENSMUST00000005509
AA Change: V255F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005509
Gene: ENSMUSG00000007207
AA Change: V255F

DomainStartEndE-ValueType
SynN 25 146 4.44e-42 SMART
t_SNARE 187 254 3.28e-24 SMART
transmembrane domain 266 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071677
SMART Domains Protein: ENSMUSP00000071600
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_11 36 120 4.7e-13 PFAM
Pfam:WBS_methylT 182 258 9.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085984
SMART Domains Protein: ENSMUSP00000083146
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 143 5.3e-11 PFAM
Pfam:WBS_methylT 204 279 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111205
SMART Domains Protein: ENSMUSP00000106836
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 142 1.1e-12 PFAM
Pfam:WBS_methylT 168 245 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129691
SMART Domains Protein: ENSMUSP00000120383
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:WBS_methylT 88 138 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147756
Predicted Effect probably benign
Transcript: ENSMUST00000150838
SMART Domains Protein: ENSMUSP00000117144
Gene: ENSMUSG00000007207

DomainStartEndE-ValueType
SynN 25 146 4.44e-42 SMART
Pfam:SNARE 197 231 6.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157383
Predicted Effect probably benign
Transcript: ENSMUST00000201008
SMART Domains Protein: ENSMUSP00000144082
Gene: ENSMUSG00000007207

DomainStartEndE-ValueType
SynN 25 121 1.3e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202478
Meta Mutation Damage Score 0.2927 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin superfamily. Syntaxins are nervous system-specific proteins implicated in the docking of synaptic vesicles with the presynaptic plasma membrane. Syntaxins possess a single C-terminal transmembrane domain, a SNARE [Soluble NSF (N-ethylmaleimide-sensitive fusion protein)-Attachment protein REceptor] domain (known as H3), and an N-terminal regulatory domain (Habc). Syntaxins bind synaptotagmin in a calcium-dependent fashion and interact with voltage dependent calcium and potassium channels via the C-terminal H3 domain. This gene product is a key molecule in ion channel regulation and synaptic exocytosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mice for one targeted mutation display impairments in LTP, cued fear memory consolidation and cued fear memory extinction while mice with another targeted mutation show no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Stx1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Stx1a APN 5 135045664 missense probably damaging 0.99
IGL01956:Stx1a APN 5 135037469 splice site probably benign
IGL02448:Stx1a APN 5 135023619 splice site probably benign
R0140:Stx1a UTSW 5 135045585 splice site probably benign
R0840:Stx1a UTSW 5 135041234 intron probably benign
R7345:Stx1a UTSW 5 135037188 missense probably benign 0.00
R7536:Stx1a UTSW 5 135049840 missense probably damaging 1.00
R8085:Stx1a UTSW 5 135037577 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTAGCTGTCTTGTCCTCAGG -3'
(R):5'- GGATGGCCTAGAACGGATTG -3'

Sequencing Primer
(F):5'- CAGGTGAGAGGCTGCATGC -3'
(R):5'- CCTAGAACGGATTGTTGATGAAG -3'
Posted On2016-12-15