Incidental Mutation 'R5810:Snrpd2'
ID447465
Institutional Source Beutler Lab
Gene Symbol Snrpd2
Ensembl Gene ENSMUSG00000040824
Gene Namesmall nuclear ribonucleoprotein D2
SynonymsSMD2, 1810009A06Rik
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19149722-19153542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19152522 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 77 (V77F)
Ref Sequence ENSEMBL: ENSMUSP00000037597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032566] [ENSMUST00000049294] [ENSMUST00000094790]
Predicted Effect probably benign
Transcript: ENSMUST00000032566
SMART Domains Protein: ENSMUSP00000032566
Gene: ENSMUSG00000030407

DomainStartEndE-ValueType
low complexity region 27 48 N/A INTRINSIC
Pfam:Peptidase_M28 151 377 2.3e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049294
AA Change: V77F

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037597
Gene: ENSMUSG00000040824
AA Change: V77F

DomainStartEndE-ValueType
Sm 32 111 3.94e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094790
SMART Domains Protein: ENSMUSP00000092384
Gene: ENSMUSG00000030406

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
HormR 53 123 6.14e-23 SMART
Pfam:7tm_2 130 384 1.3e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206857
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the small nuclear ribonucleoprotein core protein family. It is required for pre-mRNA splicing and small nuclear ribonucleoprotein biogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Snrpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4049:Snrpd2 UTSW 7 19151307 missense probably damaging 0.96
R5502:Snrpd2 UTSW 7 19151322 missense probably benign 0.06
R5732:Snrpd2 UTSW 7 19152613 splice site probably null
Predicted Primers PCR Primer
(F):5'- AATCACTTTGCAGCCTGCC -3'
(R):5'- ACTCTTTTAAGACCCAAGAGCAG -3'

Sequencing Primer
(F):5'- CCATCCCCACTGTGGAGC -3'
(R):5'- AAAGCACAGGGTTTTATTTCTCGCC -3'
Posted On2016-12-15