Incidental Mutation 'R5810:Gpatch1'
ID447466
Institutional Source Beutler Lab
Gene Symbol Gpatch1
Ensembl Gene ENSMUSG00000063808
Gene NameG patch domain containing 1
SynonymsGpatc1, 1300003A17Rik
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location35276536-35318440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35295371 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 490 (A490V)
Ref Sequence ENSEMBL: ENSMUSP00000078632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079693] [ENSMUST00000131143] [ENSMUST00000131213]
Predicted Effect probably benign
Transcript: ENSMUST00000079693
AA Change: A490V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078632
Gene: ENSMUSG00000063808
AA Change: A490V

DomainStartEndE-ValueType
Pfam:DUF1604 31 116 2.1e-39 PFAM
G_patch 150 191 4.72e-1 SMART
low complexity region 200 209 N/A INTRINSIC
low complexity region 456 478 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 759 780 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 847 897 N/A INTRINSIC
low complexity region 899 909 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131143
SMART Domains Protein: ENSMUSP00000121711
Gene: ENSMUSG00000063808

DomainStartEndE-ValueType
Pfam:DUF1604 29 98 2.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131213
AA Change: A490V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117475
Gene: ENSMUSG00000063808
AA Change: A490V

DomainStartEndE-ValueType
Pfam:DUF1604 31 116 7.9e-40 PFAM
G_patch 150 191 4.72e-1 SMART
low complexity region 200 209 N/A INTRINSIC
low complexity region 456 478 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 759 780 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 849 881 N/A INTRINSIC
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Gpatch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Gpatch1 APN 7 35276813 critical splice acceptor site probably null
IGL01143:Gpatch1 APN 7 35301572 splice site probably benign
IGL01523:Gpatch1 APN 7 35308338 missense probably null 1.00
IGL01862:Gpatch1 APN 7 35295278 missense probably benign
IGL02349:Gpatch1 APN 7 35307255 missense probably damaging 1.00
IGL02792:Gpatch1 APN 7 35301593 missense probably damaging 0.96
IGL02926:Gpatch1 APN 7 35308269 missense probably damaging 1.00
IGL03099:Gpatch1 APN 7 35297523 missense possibly damaging 0.87
IGL03107:Gpatch1 APN 7 35303317 missense probably benign 0.35
IGL03324:Gpatch1 APN 7 35299280 missense probably damaging 0.96
IGL03324:Gpatch1 APN 7 35293695 missense possibly damaging 0.81
R0066:Gpatch1 UTSW 7 35287227 missense probably damaging 1.00
R0066:Gpatch1 UTSW 7 35287227 missense probably damaging 1.00
R0137:Gpatch1 UTSW 7 35287242 missense probably damaging 1.00
R0347:Gpatch1 UTSW 7 35297631 missense probably benign 0.16
R0382:Gpatch1 UTSW 7 35301655 missense probably damaging 1.00
R0390:Gpatch1 UTSW 7 35281381 intron probably benign
R0791:Gpatch1 UTSW 7 35281376 intron probably benign
R1162:Gpatch1 UTSW 7 35303480 splice site probably benign
R1374:Gpatch1 UTSW 7 35291762 missense probably damaging 1.00
R1480:Gpatch1 UTSW 7 35303338 missense probably damaging 1.00
R1556:Gpatch1 UTSW 7 35295351 missense probably benign 0.00
R1682:Gpatch1 UTSW 7 35303387 missense possibly damaging 0.80
R1887:Gpatch1 UTSW 7 35303388 missense probably damaging 0.98
R1935:Gpatch1 UTSW 7 35295522 missense probably damaging 1.00
R1936:Gpatch1 UTSW 7 35295522 missense probably damaging 1.00
R2148:Gpatch1 UTSW 7 35299276 missense probably benign 0.16
R2205:Gpatch1 UTSW 7 35291772 missense probably damaging 1.00
R2215:Gpatch1 UTSW 7 35293827 missense possibly damaging 0.48
R2274:Gpatch1 UTSW 7 35288678 missense probably benign 0.00
R2275:Gpatch1 UTSW 7 35288678 missense probably benign 0.00
R4126:Gpatch1 UTSW 7 35293654 critical splice donor site probably null
R4705:Gpatch1 UTSW 7 35299305 splice site probably null
R5227:Gpatch1 UTSW 7 35309351 missense probably benign 0.09
R5567:Gpatch1 UTSW 7 35307215 missense probably damaging 0.99
R5946:Gpatch1 UTSW 7 35291832 missense probably damaging 0.99
R6263:Gpatch1 UTSW 7 35303423 missense probably damaging 1.00
R6386:Gpatch1 UTSW 7 35291840 missense probably damaging 1.00
R6569:Gpatch1 UTSW 7 35291738 missense probably damaging 1.00
R6847:Gpatch1 UTSW 7 35293558 splice site probably null
R7186:Gpatch1 UTSW 7 35295313 missense possibly damaging 0.86
R7259:Gpatch1 UTSW 7 35287121 critical splice donor site probably null
R7276:Gpatch1 UTSW 7 35297496 missense probably benign 0.00
R7516:Gpatch1 UTSW 7 35308200 missense probably benign 0.09
R7521:Gpatch1 UTSW 7 35293788 missense probably damaging 1.00
R7561:Gpatch1 UTSW 7 35309375 missense probably damaging 1.00
R7570:Gpatch1 UTSW 7 35293812 missense probably damaging 1.00
R7588:Gpatch1 UTSW 7 35291748 missense probably damaging 1.00
R7843:Gpatch1 UTSW 7 35281454 missense unknown
R8353:Gpatch1 UTSW 7 35277279 intron probably benign
R8430:Gpatch1 UTSW 7 35308209 missense probably damaging 1.00
R8669:Gpatch1 UTSW 7 35291779 missense probably damaging 1.00
X0020:Gpatch1 UTSW 7 35295381 missense probably benign 0.09
Z1176:Gpatch1 UTSW 7 35310485 missense probably damaging 1.00
Z1186:Gpatch1 UTSW 7 35281372 missense unknown
Z1186:Gpatch1 UTSW 7 35297654 missense possibly damaging 0.91
Z1186:Gpatch1 UTSW 7 35318345 missense probably benign
Z1191:Gpatch1 UTSW 7 35281372 missense unknown
Z1191:Gpatch1 UTSW 7 35297654 missense possibly damaging 0.91
Z1191:Gpatch1 UTSW 7 35318345 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACCATTTATACCAAGTGGACC -3'
(R):5'- TCAGCTACTTCAGTGTTGGAG -3'

Sequencing Primer
(F):5'- AAGCGGCTTGACTTGCAG -3'
(R):5'- AGTGTTGGAGTTTCTGTCTCAAAAAG -3'
Posted On2016-12-15