Mutagenetix > Incidental Mutation

Incidental Mutation 'R5810:Ddx60'

447471

Institutional Source

Beutler Lab

Gene Symbol

Ddx60

Ensembl Gene

ENSMUSG00000037921

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

Synonyms

MMRRC Submission

043395-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R5810 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61928087-62038244 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 62012388 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1360 (Q1360*)

Ref Sequence

ENSEMBL: ENSMUSP00000091197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]

AlphaFold

E9PZQ1

Predicted Effect

probably null
Transcript: ENSMUST00000070631
AA Change: Q1359*

SMART Domains

Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: Q1359*

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	758	949	1.05e-15	SMART
Blast:DEXDc	1007	1132	4e-24	BLAST
HELICc	1245	1328	4.35e-13	SMART
low complexity region	1362	1373	N/A	INTRINSIC
Blast:DEXDc	1503	1584	1e-20	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000093485
AA Change: Q1360*

SMART Domains

Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: Q1360*

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	759	950	1.05e-15	SMART
Blast:DEXDc	1008	1133	4e-24	BLAST
HELICc	1246	1329	4.35e-13	SMART
low complexity region	1363	1374	N/A	INTRINSIC
Blast:DEXDc	1504	1585	1e-20	BLAST

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

100% (66/66)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,079,631	F866L	probably benign	Het
Abca16	T	A	7: 120,435,932	C314S	probably damaging	Het
Actl11	C	T	9: 107,929,221	P248S	probably benign	Het
Actr3	A	G	1: 125,416,379		probably benign	Het
Baz1a	G	A	12: 54,927,715		probably benign	Het
Birc6	A	C	17: 74,670,374	N4388T	probably damaging	Het
Bpifa5	G	A	2: 154,163,718		probably null	Het
Car13	A	C	3: 14,641,768		probably null	Het
Ceacam18	A	T	7: 43,636,958	H85L	probably benign	Het
Cnnm3	A	G	1: 36,525,199	E704G	probably benign	Het
Cyp4f14	T	A	17: 32,906,098	I450F	possibly damaging	Het
Ddhd1	G	T	14: 45,602,707	T710N	probably damaging	Het
Dlg5	A	G	14: 24,146,254	V1625A	probably damaging	Het
Dst	G	A	1: 34,183,040		probably benign	Het
Dyrk2	G	T	10: 118,860,340	H338N	probably benign	Het
Epb41l1	A	T	2: 156,499,655	I187F	probably damaging	Het
Esd	A	G	14: 74,745,611	D221G	probably damaging	Het
Fam53b	T	A	7: 132,760,164	N45I	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fryl	A	T	5: 73,090,755	D1006E	probably benign	Het
Gli3	T	C	13: 15,644,309	V232A	probably damaging	Het
Gm12666	A	T	4: 92,191,583		probably null	Het
Gm28308	C	A	6: 52,213,216		probably benign	Het
Gpatch1	G	A	7: 35,295,371	A490V	probably benign	Het
Hoxa7	T	C	6: 52,216,024	D128G	probably benign	Het
Igdcc4	A	G	9: 65,128,695	T751A	probably damaging	Het
Igsf10	G	A	3: 59,319,071	L2394F	probably damaging	Het
Il15ra	A	G	2: 11,733,252		probably null	Het
Il17re	C	T	6: 113,469,596	A436V	probably damaging	Het
Krtap19-2	T	C	16: 88,874,236		probably benign	Het
Lgals12	T	C	19: 7,606,720	D4G	probably benign	Het
Liph	A	T	16: 21,968,110	L252Q	probably damaging	Het
Mtg1	T	A	7: 140,145,985		probably null	Het
Myo18b	A	G	5: 112,834,450	L1139P	probably damaging	Het
Ninl	T	C	2: 150,950,168	R812G	probably benign	Het
Npm3	A	G	19: 45,748,205	I165T	possibly damaging	Het
Olfr381	G	T	11: 73,486,095	S243*	probably null	Het
Osbpl9	A	G	4: 109,086,374	V231A	probably benign	Het
Pgam2	T	C	11: 5,803,417	H91R	possibly damaging	Het
Pkhd1	A	G	1: 20,200,673	W3219R	probably benign	Het
Procr	A	G	2: 155,751,407	K4E	possibly damaging	Het
Slc22a16	C	T	10: 40,595,318	T495I	possibly damaging	Het
Slc22a6	A	G	19: 8,623,858	K425E	probably damaging	Het
Slco6c1	A	T	1: 97,075,873	C500S	probably damaging	Het
Snrpd2	G	T	7: 19,152,522	V77F	probably benign	Het
Sp100	G	A	1: 85,665,285	G145D	probably benign	Het
Spg7	G	A	8: 123,094,569	E678K	possibly damaging	Het
Ssh1	T	C	5: 113,946,566	K538E	probably benign	Het
Sspo	C	T	6: 48,483,898	R3356W	probably benign	Het
Stx1a	G	T	5: 135,049,078	V255F	probably damaging	Het
Tbc1d13	C	A	2: 30,142,368	Q164K	probably benign	Het
Tfpi	AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA	AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA	2: 84,434,424		probably benign	Het
Tpm2	T	C	4: 43,518,968		probably benign	Het
Triobp	T	C	15: 78,968,267	C874R	probably benign	Het
Tymp	T	A	15: 89,374,331	H269L	probably damaging	Het
Vmn1r194	T	A	13: 22,244,427	Y71*	probably null	Het
Vmn2r102	T	C	17: 19,677,542	V273A	probably benign	Het
Vmn2r2	A	T	3: 64,117,394	C589S	probably damaging	Het
Vps13a	T	C	19: 16,666,324	T2063A	probably benign	Het
Ywhaz	T	C	15: 36,775,266	I217M	probably damaging	Het
Zfp322a	A	C	13: 23,357,409	Y54*	probably null	Het
Zswim9	A	T	7: 13,260,735	V498D	probably damaging	Het

Other mutations in Ddx60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ddx60	APN	8	61958646	missense	probably damaging	1.00
IGL00915:Ddx60	APN	8	61987431	missense	possibly damaging	0.79
IGL00931:Ddx60	APN	8	61969583	missense	probably benign	0.18
IGL01023:Ddx60	APN	8	61942514	missense	probably damaging	0.99
IGL01313:Ddx60	APN	8	61982526	missense	probably damaging	1.00
IGL01615:Ddx60	APN	8	61963740	missense	probably null	0.81
IGL01733:Ddx60	APN	8	61983865	missense	probably damaging	0.99
IGL01779:Ddx60	APN	8	62017823	missense	possibly damaging	0.94
IGL01900:Ddx60	APN	8	62000709	splice site	probably benign
IGL02110:Ddx60	APN	8	62017247	critical splice donor site	probably null
IGL02302:Ddx60	APN	8	61975832	missense	possibly damaging	0.85
IGL02468:Ddx60	APN	8	61958642	missense	probably damaging	1.00
IGL02569:Ddx60	APN	8	62024951	missense	possibly damaging	0.93
IGL02622:Ddx60	APN	8	61942436	splice site	probably null
IGL02657:Ddx60	APN	8	61984115	missense	probably benign	0.01
IGL02677:Ddx60	APN	8	61988132	missense	probably damaging	1.00
IGL02701:Ddx60	APN	8	61979341	missense	probably damaging	0.96
IGL02806:Ddx60	APN	8	61956122	missense	probably benign	0.00
IGL03137:Ddx60	APN	8	61988083	missense	possibly damaging	0.61
IGL03295:Ddx60	APN	8	61956121	missense	possibly damaging	0.82
IGL03387:Ddx60	APN	8	62012449	missense	probably damaging	1.00
IGL03411:Ddx60	APN	8	61977882	critical splice acceptor site	probably null
Scatter	UTSW	8	62021314	missense	possibly damaging	0.80
shotgun	UTSW	8	62037067	missense	probably benign	0.28
splay	UTSW	8	62021309	missense	possibly damaging	0.80
G1Funyon:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
PIT4504001:Ddx60	UTSW	8	61958113	missense	probably benign
PIT4677001:Ddx60	UTSW	8	61972254	missense	possibly damaging	0.87
R0090:Ddx60	UTSW	8	61942293	missense	probably damaging	1.00
R0266:Ddx60	UTSW	8	62033493	missense	possibly damaging	0.92
R0325:Ddx60	UTSW	8	61983855	missense	probably benign	0.00
R0367:Ddx60	UTSW	8	62017749	missense	possibly damaging	0.78
R0403:Ddx60	UTSW	8	61994541	splice site	probably benign
R0479:Ddx60	UTSW	8	61969657	missense	probably damaging	1.00
R0561:Ddx60	UTSW	8	62017794	missense	possibly damaging	0.93
R0844:Ddx60	UTSW	8	61987361	missense	probably benign	0.27
R1119:Ddx60	UTSW	8	61942544	missense	probably damaging	1.00
R1428:Ddx60	UTSW	8	61958159	splice site	probably benign
R1778:Ddx60	UTSW	8	61974176	missense	possibly damaging	0.85
R1840:Ddx60	UTSW	8	61969553	missense	probably damaging	0.99
R1964:Ddx60	UTSW	8	61948869	missense	probably benign	0.10
R1970:Ddx60	UTSW	8	61972206	missense	possibly damaging	0.93
R2101:Ddx60	UTSW	8	61940645	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	61956141	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	62017200	missense	probably benign	0.01
R2198:Ddx60	UTSW	8	61958063	missense	possibly damaging	0.79
R2332:Ddx60	UTSW	8	62037091	missense	probably benign	0.08
R2338:Ddx60	UTSW	8	62012436	missense	possibly damaging	0.91
R2379:Ddx60	UTSW	8	62037088	missense	probably damaging	1.00
R4010:Ddx60	UTSW	8	61954535	missense	possibly damaging	0.65
R4010:Ddx60	UTSW	8	61956144	missense	probably benign	0.25
R4133:Ddx60	UTSW	8	61972220	missense	probably damaging	0.99
R4282:Ddx60	UTSW	8	61994393	missense	probably damaging	0.99
R4382:Ddx60	UTSW	8	61948978	splice site	probably null
R4561:Ddx60	UTSW	8	61942461	missense	probably damaging	0.96
R4572:Ddx60	UTSW	8	61987421	missense	probably damaging	1.00
R4581:Ddx60	UTSW	8	62023261	missense	possibly damaging	0.90
R4635:Ddx60	UTSW	8	62037067	missense	probably benign	0.28
R4698:Ddx60	UTSW	8	62012424	missense	probably benign	0.01
R4807:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R4858:Ddx60	UTSW	8	62021314	missense	possibly damaging	0.80
R4964:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R5120:Ddx60	UTSW	8	61945906	missense	probably benign	0.01
R5187:Ddx60	UTSW	8	61974188	missense	probably damaging	1.00
R5222:Ddx60	UTSW	8	61984158	missense	probably damaging	0.99
R5400:Ddx60	UTSW	8	62010002	missense	possibly damaging	0.65
R5500:Ddx60	UTSW	8	61950451	missense	probably benign	0.28
R5514:Ddx60	UTSW	8	61958057	missense	probably damaging	1.00
R5668:Ddx60	UTSW	8	62000578	missense	probably benign	0.38
R5742:Ddx60	UTSW	8	61948921	missense	probably benign
R5772:Ddx60	UTSW	8	61948897	missense	probably damaging	1.00
R5815:Ddx60	UTSW	8	61963722	missense	probably damaging	0.98
R5820:Ddx60	UTSW	8	61956121	missense	possibly damaging	0.82
R5866:Ddx60	UTSW	8	61940740	missense	probably damaging	1.00
R5881:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R5977:Ddx60	UTSW	8	62021410	critical splice donor site	probably null
R6048:Ddx60	UTSW	8	62000582	missense	probably benign	0.01
R6061:Ddx60	UTSW	8	62023241	missense	probably null	0.01
R6153:Ddx60	UTSW	8	61945940	missense	possibly damaging	0.47
R6287:Ddx60	UTSW	8	61950578	missense	probably damaging	1.00
R6415:Ddx60	UTSW	8	61983905	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61977950	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61998681	missense	probably benign
R6660:Ddx60	UTSW	8	61956239	missense	probably benign	0.00
R6694:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R6715:Ddx60	UTSW	8	61983890	missense	probably benign	0.03
R6720:Ddx60	UTSW	8	62000689	missense	probably benign	0.10
R6937:Ddx60	UTSW	8	62037069	missense	probably damaging	1.00
R7153:Ddx60	UTSW	8	61988108	missense	possibly damaging	0.71
R7274:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R7409:Ddx60	UTSW	8	61958578	missense	probably benign	0.24
R7464:Ddx60	UTSW	8	61940674	missense	possibly damaging	0.82
R7670:Ddx60	UTSW	8	61975792	missense	probably damaging	1.00
R7904:Ddx60	UTSW	8	61977890	missense	possibly damaging	0.81
R7992:Ddx60	UTSW	8	61954535	missense	probably benign	0.03
R8124:Ddx60	UTSW	8	61983911	missense	probably benign
R8125:Ddx60	UTSW	8	61983911	missense	probably benign
R8126:Ddx60	UTSW	8	61983911	missense	probably benign
R8155:Ddx60	UTSW	8	62017171	missense	possibly damaging	0.61
R8174:Ddx60	UTSW	8	62017250	splice site	probably null
R8192:Ddx60	UTSW	8	61977968	missense	probably damaging	1.00
R8271:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R8301:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
R8304:Ddx60	UTSW	8	61998769	missense	possibly damaging	0.67
R8319:Ddx60	UTSW	8	61942635	critical splice donor site	probably null
R8374:Ddx60	UTSW	8	61974171	missense	probably benign	0.01
R8401:Ddx60	UTSW	8	61956243	missense	possibly damaging	0.57
R8487:Ddx60	UTSW	8	61974150	missense	probably damaging	1.00
R8804:Ddx60	UTSW	8	61958606	missense	probably benign	0.27
R8826:Ddx60	UTSW	8	61945956	missense	probably benign	0.02
R8829:Ddx60	UTSW	8	61940661	missense	probably damaging	1.00
R8881:Ddx60	UTSW	8	62021309	missense	possibly damaging	0.80
R8884:Ddx60	UTSW	8	61994519	missense	possibly damaging	0.86
R8990:Ddx60	UTSW	8	61974134	nonsense	probably null
R9122:Ddx60	UTSW	8	61989864	missense	probably benign	0.16
R9225:Ddx60	UTSW	8	62017841	missense	probably benign	0.36
R9278:Ddx60	UTSW	8	61977978	missense	possibly damaging	0.83
R9293:Ddx60	UTSW	8	62009960	missense	possibly damaging	0.89
R9405:Ddx60	UTSW	8	61972214	missense	probably benign	0.03
X0003:Ddx60	UTSW	8	62033417	missense	possibly damaging	0.88
X0019:Ddx60	UTSW	8	61963692	missense	probably benign	0.01
Z1177:Ddx60	UTSW	8	62000588	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TAACCTCCATATGCAGCATACGTG -3'
(R):5'- GACCCCAAAGTCATGGCAAG -3'

Sequencing Primer
(F):5'- GTAAAAGGCTTAATCTCTTCAACCC -3'
(R):5'- TGGCAAGCCAAATAAAAGCACAG -3'

Posted On

2016-12-15