Incidental Mutation 'R5810:Ddx60'
ID 447471
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission 043395-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.199) question?
Stock # R5810 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 61928087-62038244 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 62012388 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1360 (Q1360*)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
AlphaFold E9PZQ1
Predicted Effect probably null
Transcript: ENSMUST00000070631
AA Change: Q1359*
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: Q1359*

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000093485
AA Change: Q1360*
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: Q1360*

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 (GRCm38) F866L probably benign Het
Abca16 T A 7: 120,435,932 (GRCm38) C314S probably damaging Het
Actl11 C T 9: 107,929,221 (GRCm38) P248S probably benign Het
Actr3 A G 1: 125,416,379 (GRCm38) probably benign Het
Baz1a G A 12: 54,927,715 (GRCm38) probably benign Het
Birc6 A C 17: 74,670,374 (GRCm38) N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 (GRCm38) probably null Het
Car13 A C 3: 14,641,768 (GRCm38) probably null Het
Ceacam18 A T 7: 43,636,958 (GRCm38) H85L probably benign Het
Cnnm3 A G 1: 36,525,199 (GRCm38) E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 (GRCm38) I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 (GRCm38) T710N probably damaging Het
Dlg5 A G 14: 24,146,254 (GRCm38) V1625A probably damaging Het
Dst G A 1: 34,183,040 (GRCm38) probably benign Het
Dyrk2 G T 10: 118,860,340 (GRCm38) H338N probably benign Het
Epb41l1 A T 2: 156,499,655 (GRCm38) I187F probably damaging Het
Esd A G 14: 74,745,611 (GRCm38) D221G probably damaging Het
Fam53b T A 7: 132,760,164 (GRCm38) N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 (GRCm38) probably benign Het
Fryl A T 5: 73,090,755 (GRCm38) D1006E probably benign Het
Gli3 T C 13: 15,644,309 (GRCm38) V232A probably damaging Het
Gm28308 C A 6: 52,213,216 (GRCm38) probably benign Het
Gpatch1 G A 7: 35,295,371 (GRCm38) A490V probably benign Het
Hoxa7 T C 6: 52,216,024 (GRCm38) D128G probably benign Het
Igdcc4 A G 9: 65,128,695 (GRCm38) T751A probably damaging Het
Igsf10 G A 3: 59,319,071 (GRCm38) L2394F probably damaging Het
Il15ra A G 2: 11,733,252 (GRCm38) probably null Het
Il17re C T 6: 113,469,596 (GRCm38) A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 (GRCm38) probably benign Het
Larp7-ps A T 4: 92,191,583 (GRCm38) probably null Het
Lgals12 T C 19: 7,606,720 (GRCm38) D4G probably benign Het
Liph A T 16: 21,968,110 (GRCm38) L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 (GRCm38) probably null Het
Myo18b A G 5: 112,834,450 (GRCm38) L1139P probably damaging Het
Ninl T C 2: 150,950,168 (GRCm38) R812G probably benign Het
Npm3 A G 19: 45,748,205 (GRCm38) I165T possibly damaging Het
Or1e22 G T 11: 73,486,095 (GRCm38) S243* probably null Het
Osbpl9 A G 4: 109,086,374 (GRCm38) V231A probably benign Het
Pgam2 T C 11: 5,803,417 (GRCm38) H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 (GRCm38) W3219R probably benign Het
Procr A G 2: 155,751,407 (GRCm38) K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 (GRCm38) T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 (GRCm38) K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 (GRCm38) C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 (GRCm38) V77F probably benign Het
Sp100 G A 1: 85,665,285 (GRCm38) G145D probably benign Het
Spg7 G A 8: 123,094,569 (GRCm38) E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 (GRCm38) K538E probably benign Het
Sspo C T 6: 48,483,898 (GRCm38) R3356W probably benign Het
Stx1a G T 5: 135,049,078 (GRCm38) V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 (GRCm38) Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 (GRCm38) probably benign Het
Tpm2 T C 4: 43,518,968 (GRCm38) probably benign Het
Triobp T C 15: 78,968,267 (GRCm38) C874R probably benign Het
Tymp T A 15: 89,374,331 (GRCm38) H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 (GRCm38) Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 (GRCm38) V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 (GRCm38) C589S probably damaging Het
Vps13a T C 19: 16,666,324 (GRCm38) T2063A probably benign Het
Ywhaz T C 15: 36,775,266 (GRCm38) I217M probably damaging Het
Zfp322a A C 13: 23,357,409 (GRCm38) Y54* probably null Het
Zswim9 A T 7: 13,260,735 (GRCm38) V498D probably damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61,958,646 (GRCm38) missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61,987,431 (GRCm38) missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61,969,583 (GRCm38) missense probably benign 0.18
IGL01023:Ddx60 APN 8 61,942,514 (GRCm38) missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61,982,526 (GRCm38) missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61,963,740 (GRCm38) missense probably null 0.81
IGL01733:Ddx60 APN 8 61,983,865 (GRCm38) missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62,017,823 (GRCm38) missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62,000,709 (GRCm38) splice site probably benign
IGL02110:Ddx60 APN 8 62,017,247 (GRCm38) critical splice donor site probably null
IGL02302:Ddx60 APN 8 61,975,832 (GRCm38) missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61,958,642 (GRCm38) missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62,024,951 (GRCm38) missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61,942,436 (GRCm38) splice site probably null
IGL02657:Ddx60 APN 8 61,984,115 (GRCm38) missense probably benign 0.01
IGL02677:Ddx60 APN 8 61,988,132 (GRCm38) missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61,979,341 (GRCm38) missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61,956,122 (GRCm38) missense probably benign 0.00
IGL03137:Ddx60 APN 8 61,988,083 (GRCm38) missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61,956,121 (GRCm38) missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62,012,449 (GRCm38) missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61,977,882 (GRCm38) critical splice acceptor site probably null
Scatter UTSW 8 62,021,314 (GRCm38) missense possibly damaging 0.80
shotgun UTSW 8 62,037,067 (GRCm38) missense probably benign 0.28
splay UTSW 8 62,021,309 (GRCm38) missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62,000,597 (GRCm38) missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 61,958,113 (GRCm38) missense probably benign
PIT4677001:Ddx60 UTSW 8 61,972,254 (GRCm38) missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61,942,293 (GRCm38) missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62,033,493 (GRCm38) missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61,983,855 (GRCm38) missense probably benign 0.00
R0367:Ddx60 UTSW 8 62,017,749 (GRCm38) missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61,994,541 (GRCm38) splice site probably benign
R0479:Ddx60 UTSW 8 61,969,657 (GRCm38) missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62,017,794 (GRCm38) missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61,987,361 (GRCm38) missense probably benign 0.27
R1119:Ddx60 UTSW 8 61,942,544 (GRCm38) missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61,958,159 (GRCm38) splice site probably benign
R1778:Ddx60 UTSW 8 61,974,176 (GRCm38) missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61,969,553 (GRCm38) missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61,948,869 (GRCm38) missense probably benign 0.10
R1970:Ddx60 UTSW 8 61,972,206 (GRCm38) missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61,940,645 (GRCm38) missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62,017,200 (GRCm38) missense probably benign 0.01
R2174:Ddx60 UTSW 8 61,956,141 (GRCm38) missense probably damaging 1.00
R2198:Ddx60 UTSW 8 61,958,063 (GRCm38) missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62,037,091 (GRCm38) missense probably benign 0.08
R2338:Ddx60 UTSW 8 62,012,436 (GRCm38) missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62,037,088 (GRCm38) missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61,956,144 (GRCm38) missense probably benign 0.25
R4010:Ddx60 UTSW 8 61,954,535 (GRCm38) missense possibly damaging 0.65
R4133:Ddx60 UTSW 8 61,972,220 (GRCm38) missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61,994,393 (GRCm38) missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61,948,978 (GRCm38) splice site probably null
R4561:Ddx60 UTSW 8 61,942,461 (GRCm38) missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61,987,421 (GRCm38) missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62,023,261 (GRCm38) missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62,037,067 (GRCm38) missense probably benign 0.28
R4698:Ddx60 UTSW 8 62,012,424 (GRCm38) missense probably benign 0.01
R4807:Ddx60 UTSW 8 61,979,338 (GRCm38) missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62,021,314 (GRCm38) missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61,979,338 (GRCm38) missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61,945,906 (GRCm38) missense probably benign 0.01
R5187:Ddx60 UTSW 8 61,974,188 (GRCm38) missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61,984,158 (GRCm38) missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62,010,002 (GRCm38) missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61,950,451 (GRCm38) missense probably benign 0.28
R5514:Ddx60 UTSW 8 61,958,057 (GRCm38) missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62,000,578 (GRCm38) missense probably benign 0.38
R5742:Ddx60 UTSW 8 61,948,921 (GRCm38) missense probably benign
R5772:Ddx60 UTSW 8 61,948,897 (GRCm38) missense probably damaging 1.00
R5815:Ddx60 UTSW 8 61,963,722 (GRCm38) missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61,956,121 (GRCm38) missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61,940,740 (GRCm38) missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62,037,070 (GRCm38) missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62,021,410 (GRCm38) critical splice donor site probably null
R6048:Ddx60 UTSW 8 62,000,582 (GRCm38) missense probably benign 0.01
R6061:Ddx60 UTSW 8 62,023,241 (GRCm38) missense probably null 0.01
R6153:Ddx60 UTSW 8 61,945,940 (GRCm38) missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61,950,578 (GRCm38) missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61,983,905 (GRCm38) missense probably benign 0.00
R6416:Ddx60 UTSW 8 61,998,681 (GRCm38) missense probably benign
R6416:Ddx60 UTSW 8 61,977,950 (GRCm38) missense probably benign 0.00
R6660:Ddx60 UTSW 8 61,956,239 (GRCm38) missense probably benign 0.00
R6694:Ddx60 UTSW 8 62,037,070 (GRCm38) missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61,983,890 (GRCm38) missense probably benign 0.03
R6720:Ddx60 UTSW 8 62,000,689 (GRCm38) missense probably benign 0.10
R6937:Ddx60 UTSW 8 62,037,069 (GRCm38) missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61,988,108 (GRCm38) missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61,940,108 (GRCm38) critical splice donor site probably null
R7409:Ddx60 UTSW 8 61,958,578 (GRCm38) missense probably benign 0.24
R7464:Ddx60 UTSW 8 61,940,674 (GRCm38) missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61,975,792 (GRCm38) missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61,977,890 (GRCm38) missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61,954,535 (GRCm38) missense probably benign 0.03
R8124:Ddx60 UTSW 8 61,983,911 (GRCm38) missense probably benign
R8125:Ddx60 UTSW 8 61,983,911 (GRCm38) missense probably benign
R8126:Ddx60 UTSW 8 61,983,911 (GRCm38) missense probably benign
R8155:Ddx60 UTSW 8 62,017,171 (GRCm38) missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62,017,250 (GRCm38) splice site probably null
R8192:Ddx60 UTSW 8 61,977,968 (GRCm38) missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61,940,108 (GRCm38) critical splice donor site probably null
R8301:Ddx60 UTSW 8 62,000,597 (GRCm38) missense probably benign 0.01
R8304:Ddx60 UTSW 8 61,998,769 (GRCm38) missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61,942,635 (GRCm38) critical splice donor site probably null
R8374:Ddx60 UTSW 8 61,974,171 (GRCm38) missense probably benign 0.01
R8401:Ddx60 UTSW 8 61,956,243 (GRCm38) missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 61,974,150 (GRCm38) missense probably damaging 1.00
R8804:Ddx60 UTSW 8 61,958,606 (GRCm38) missense probably benign 0.27
R8826:Ddx60 UTSW 8 61,945,956 (GRCm38) missense probably benign 0.02
R8829:Ddx60 UTSW 8 61,940,661 (GRCm38) missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62,021,309 (GRCm38) missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 61,994,519 (GRCm38) missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 61,974,134 (GRCm38) nonsense probably null
R9122:Ddx60 UTSW 8 61,989,864 (GRCm38) missense probably benign 0.16
R9225:Ddx60 UTSW 8 62,017,841 (GRCm38) missense probably benign 0.36
R9278:Ddx60 UTSW 8 61,977,978 (GRCm38) missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62,009,960 (GRCm38) missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 61,972,214 (GRCm38) missense probably benign 0.03
R9766:Ddx60 UTSW 8 62,012,278 (GRCm38) missense probably damaging 1.00
X0003:Ddx60 UTSW 8 62,033,417 (GRCm38) missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61,963,692 (GRCm38) missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62,000,588 (GRCm38) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TAACCTCCATATGCAGCATACGTG -3'
(R):5'- GACCCCAAAGTCATGGCAAG -3'

Sequencing Primer
(F):5'- GTAAAAGGCTTAATCTCTTCAACCC -3'
(R):5'- TGGCAAGCCAAATAAAAGCACAG -3'
Posted On 2016-12-15